Incidental Mutation 'R3148:Alg2'
ID264317
Institutional Source Beutler Lab
Gene Symbol Alg2
Ensembl Gene ENSMUSG00000039740
Gene Nameasparagine-linked glycosylation 2 (alpha-1,3-mannosyltransferase)
SynonymsALPG2, CDGIi
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location47465067-47474333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47472259 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 183 (V183D)
Ref Sequence ENSEMBL: ENSMUSP00000043580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044148] [ENSMUST00000065678] [ENSMUST00000125622] [ENSMUST00000137461]
Predicted Effect probably damaging
Transcript: ENSMUST00000044148
AA Change: V183D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043580
Gene: ENSMUSG00000039740
AA Change: V183D

DomainStartEndE-ValueType
Pfam:Glyco_transf_4 21 208 1.1e-10 PFAM
Pfam:Glyco_trans_4_4 27 189 1.3e-12 PFAM
Pfam:Glycos_transf_1 211 393 4.1e-37 PFAM
Pfam:Glyco_trans_1_4 224 379 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065678
SMART Domains Protein: ENSMUSP00000067681
Gene: ENSMUSG00000053317

DomainStartEndE-ValueType
Pfam:Sec61_beta 51 91 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136912
Predicted Effect probably benign
Transcript: ENSMUST00000137461
Predicted Effect unknown
Transcript: ENSMUST00000143104
AA Change: V55D
SMART Domains Protein: ENSMUSP00000121934
Gene: ENSMUSG00000039740
AA Change: V55D

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glycos_transf_1 84 177 6.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 1 family. The encoded protein acts as an alpha 1,3 mannosyltransferase, mannosylating Man(2)GlcNAc(2)-dolichol diphosphate and Man(1)GlcNAc(2)-dolichol diphosphate to form Man(3)GlcNAc(2)-dolichol diphosphate. Defects in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ii). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous mice die prior to genotyping age. Female heterozygous mice exhibit decreased skin fibroblast proliferation rates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Alg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Alg2 APN 4 47472329 missense probably damaging 0.99
IGL02314:Alg2 APN 4 47472143 nonsense probably null
IGL02321:Alg2 APN 4 47474249 missense probably benign 0.01
IGL02697:Alg2 APN 4 47471772 missense probably damaging 0.99
PIT4434001:Alg2 UTSW 4 47474076 missense probably benign 0.13
R1265:Alg2 UTSW 4 47474289 unclassified probably benign
R1861:Alg2 UTSW 4 47471670 missense probably benign
R3147:Alg2 UTSW 4 47472259 missense probably damaging 0.99
R4828:Alg2 UTSW 4 47471563 missense probably benign 0.31
R4937:Alg2 UTSW 4 47473974 missense probably benign 0.01
R5529:Alg2 UTSW 4 47472101 missense probably damaging 0.99
R6523:Alg2 UTSW 4 47472071 missense possibly damaging 0.50
R7007:Alg2 UTSW 4 47471881 missense probably benign 0.31
R7990:Alg2 UTSW 4 47472308 missense probably damaging 1.00
R8361:Alg2 UTSW 4 47471848 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGTAACCGATTCCGAAGC -3'
(R):5'- TGTTCAAACTGGCCAGACG -3'

Sequencing Primer
(F):5'- TGCACCAAGGATCTCAGTG -3'
(R):5'- ACGGCGTAAGAGGGTCCTATTTTAC -3'
Posted On2015-02-05