Incidental Mutation 'R3148:Gm13083'
ID264318
Institutional Source Beutler Lab
Gene Symbol Gm13083
Ensembl Gene ENSMUSG00000066688
Gene Namepredicted gene 13083
Synonyms
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143615003-143618595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143617477 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 449 (D449V)
Ref Sequence ENSEMBL: ENSMUSP00000101399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105773]
Predicted Effect probably benign
Transcript: ENSMUST00000105773
AA Change: D449V

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101399
Gene: ENSMUSG00000066688
AA Change: D449V

DomainStartEndE-ValueType
SCOP:d1a4ya_ 223 431 7e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Gm13083
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Gm13083 APN 4 143615073 missense probably benign 0.00
IGL02390:Gm13083 APN 4 143615325 missense probably benign 0.29
IGL02676:Gm13083 APN 4 143616097 missense possibly damaging 0.75
IGL03381:Gm13083 APN 4 143617055 splice site probably benign
IGL03410:Gm13083 APN 4 143615281 missense probably benign 0.02
H8562:Gm13083 UTSW 4 143615350 splice site probably benign
PIT4151001:Gm13083 UTSW 4 143616152 nonsense probably null
R0157:Gm13083 UTSW 4 143615796 missense probably damaging 0.98
R0352:Gm13083 UTSW 4 143615989 missense possibly damaging 0.92
R0494:Gm13083 UTSW 4 143616156 missense probably benign 0.33
R0688:Gm13083 UTSW 4 143617357 missense probably benign 0.00
R0884:Gm13083 UTSW 4 143615184 missense probably benign 0.01
R1267:Gm13083 UTSW 4 143615734 missense possibly damaging 0.95
R1418:Gm13083 UTSW 4 143616034 missense probably benign 0.15
R1761:Gm13083 UTSW 4 143615868 missense probably benign 0.00
R4063:Gm13083 UTSW 4 143615989 missense possibly damaging 0.77
R4115:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R4760:Gm13083 UTSW 4 143617231 missense probably benign 0.04
R5516:Gm13083 UTSW 4 143615683 missense possibly damaging 0.49
R5603:Gm13083 UTSW 4 143617496 nonsense probably null
R5724:Gm13083 UTSW 4 143617456 missense probably benign 0.06
R5796:Gm13083 UTSW 4 143615208 missense probably benign 0.12
R5879:Gm13083 UTSW 4 143617591 missense possibly damaging 0.64
R6181:Gm13083 UTSW 4 143616258 critical splice donor site probably null
R7155:Gm13083 UTSW 4 143616165 missense probably benign 0.01
R7492:Gm13083 UTSW 4 143616174 missense not run
R7913:Gm13083 UTSW 4 143615045 missense possibly damaging 0.87
R7995:Gm13083 UTSW 4 143616000 missense possibly damaging 0.89
R8126:Gm13083 UTSW 4 143617065 missense possibly damaging 0.87
Z1088:Gm13083 UTSW 4 143615232 missense possibly damaging 0.78
Z1177:Gm13083 UTSW 4 143616160 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGCTCATGGACTGGCAAATC -3'
(R):5'- AATAATGAGCCACTTGAGACCTG -3'

Sequencing Primer
(F):5'- TGGACTGGCAAATCAGTGACCTC -3'
(R):5'- AGACCTGCCTTCCATTTGTCAGAG -3'
Posted On2015-02-05