Incidental Mutation 'R3148:Asb15'
ID264321
Institutional Source Beutler Lab
Gene Symbol Asb15
Ensembl Gene ENSMUSG00000029685
Gene Nameankyrin repeat and SOCS box-containing 15
Synonyms4930400E23Rik
MMRRC Submission 040600-MU
Accession Numbers

Genbank: NM_080847; MGI: 1926160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24528144-24573164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24566259 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 404 (A404S)
Ref Sequence ENSEMBL: ENSMUSP00000112965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031696] [ENSMUST00000117688]
Predicted Effect probably damaging
Transcript: ENSMUST00000031696
AA Change: A404S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031696
Gene: ENSMUSG00000029685
AA Change: A404S

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117688
AA Change: A404S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112965
Gene: ENSMUSG00000029685
AA Change: A404S

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling box superfamily. The proteins in this superfamily participate in the ubiquitin-proteasome system for the degradation of proteins in the cell cycle and signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Asb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Asb15 APN 6 24558643 splice site probably benign
IGL00557:Asb15 APN 6 24558650 missense probably benign
IGL00694:Asb15 APN 6 24570664 missense possibly damaging 0.79
IGL01137:Asb15 APN 6 24556522 missense probably benign
IGL01681:Asb15 APN 6 24567138 missense probably damaging 0.98
IGL01691:Asb15 APN 6 24567272 missense probably benign 0.02
IGL01791:Asb15 APN 6 24567212 missense probably damaging 1.00
IGL01989:Asb15 APN 6 24565944 missense probably damaging 1.00
IGL02480:Asb15 APN 6 24570746 missense probably damaging 0.99
IGL02541:Asb15 APN 6 24566266 missense probably damaging 1.00
IGL02707:Asb15 APN 6 24558788 splice site probably benign
IGL03090:Asb15 APN 6 24567186 missense possibly damaging 0.52
IGL03331:Asb15 APN 6 24556524 missense possibly damaging 0.70
3-1:Asb15 UTSW 6 24566221 missense probably benign 0.00
BB002:Asb15 UTSW 6 24562724 missense probably benign 0.00
BB012:Asb15 UTSW 6 24562724 missense probably benign 0.00
R0196:Asb15 UTSW 6 24564393 missense probably damaging 0.99
R0603:Asb15 UTSW 6 24556557 missense probably damaging 1.00
R0650:Asb15 UTSW 6 24566164 missense probably damaging 1.00
R1114:Asb15 UTSW 6 24567177 missense probably damaging 1.00
R1170:Asb15 UTSW 6 24562487 splice site probably benign
R1365:Asb15 UTSW 6 24567270 missense possibly damaging 0.95
R2323:Asb15 UTSW 6 24556601 missense probably benign 0.01
R3147:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R4762:Asb15 UTSW 6 24567237 missense possibly damaging 0.81
R4771:Asb15 UTSW 6 24570622 missense probably damaging 0.99
R4915:Asb15 UTSW 6 24566293 missense probably damaging 0.96
R5369:Asb15 UTSW 6 24562564 missense probably benign 0.00
R5415:Asb15 UTSW 6 24570691 missense probably benign 0.05
R5781:Asb15 UTSW 6 24564378 missense probably benign 0.11
R6649:Asb15 UTSW 6 24562633 missense probably benign
R6653:Asb15 UTSW 6 24562633 missense probably benign
R6781:Asb15 UTSW 6 24558675 missense probably benign
R6984:Asb15 UTSW 6 24566337 missense probably benign 0.17
R7297:Asb15 UTSW 6 24566463 missense probably damaging 0.96
R7340:Asb15 UTSW 6 24558514 missense probably benign 0.00
R7419:Asb15 UTSW 6 24556556 missense probably benign 0.08
R7549:Asb15 UTSW 6 24559030 splice site probably null
R7662:Asb15 UTSW 6 24566090 missense probably benign 0.08
R7717:Asb15 UTSW 6 24559252 missense probably benign
R7767:Asb15 UTSW 6 24559282 missense probably benign
R7781:Asb15 UTSW 6 24562645 missense probably benign 0.01
R7797:Asb15 UTSW 6 24562506 missense probably damaging 0.98
R7847:Asb15 UTSW 6 24564267 missense probably damaging 1.00
R7925:Asb15 UTSW 6 24562724 missense probably benign 0.00
R8055:Asb15 UTSW 6 24556566 missense probably benign 0.05
R8304:Asb15 UTSW 6 24559297 missense possibly damaging 0.89
Z1176:Asb15 UTSW 6 24566331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGAGTTACGATGATGAGAG -3'
(R):5'- TTATGCATGATGTCCACCCTGG -3'

Sequencing Primer
(F):5'- AGAAAGACTGCGCTATACTTCG -3'
(R):5'- ATGATGTCCACCCTGGCAGTC -3'
Posted On2015-02-05