Incidental Mutation 'R3148:Pcbp1'
ID264322
Institutional Source Beutler Lab
Gene Symbol Pcbp1
Ensembl Gene ENSMUSG00000051695
Gene Namepoly(rC) binding protein 1
SynonymshnRNP E1, WBP17, [a]CP-1
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R3148 (G1)
Quality Score118
Status Not validated
Chromosome6
Chromosomal Location86524492-86526321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86525489 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 143 (E143K)
Ref Sequence ENSEMBL: ENSMUSP00000054863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053015]
Predicted Effect probably damaging
Transcript: ENSMUST00000053015
AA Change: E143K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054863
Gene: ENSMUSG00000051695
AA Change: E143K

DomainStartEndE-ValueType
KH 12 80 3.99e-16 SMART
KH 96 167 2.39e-14 SMART
KH 278 348 1.34e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205028
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit reduced body weight. Mice homozygous for the allele exhibit embryonic lethality between E3.5 and E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Pcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Pcbp1 APN 6 86525854 missense probably damaging 0.96
R2968:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R4522:Pcbp1 UTSW 6 86525050 missense probably benign 0.01
R5119:Pcbp1 UTSW 6 86524915 missense probably damaging 1.00
R5225:Pcbp1 UTSW 6 86525227 missense probably damaging 0.96
R5386:Pcbp1 UTSW 6 86525489 missense probably damaging 1.00
R5698:Pcbp1 UTSW 6 86525152 missense possibly damaging 0.93
R7135:Pcbp1 UTSW 6 86525506 missense possibly damaging 0.80
R7329:Pcbp1 UTSW 6 86525116 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTGAATCGAGTAGGCGTCTAG -3'
(R):5'- TCCATGACCAACAGTACGGC -3'

Sequencing Primer
(F):5'- TAGGCGTCTAGAGGTGGTCCC -3'
(R):5'- AACAGTACGGCGGCCAG -3'
Posted On2015-02-05