Incidental Mutation 'R3148:Tcerg1l'
ID264327
Institutional Source Beutler Lab
Gene Symbol Tcerg1l
Ensembl Gene ENSMUSG00000091002
Gene Nametranscription elongation regulator 1-like
Synonyms5730476P14Rik
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location138208974-138397730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138259867 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 378 (Q378K)
Ref Sequence ENSEMBL: ENSMUSP00000124476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160436]
Predicted Effect probably benign
Transcript: ENSMUST00000160436
AA Change: Q378K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124476
Gene: ENSMUSG00000091002
AA Change: Q378K

DomainStartEndE-ValueType
low complexity region 6 44 N/A INTRINSIC
low complexity region 52 97 N/A INTRINSIC
WW 146 178 2.11e1 SMART
low complexity region 235 249 N/A INTRINSIC
WW 344 376 3.29e-4 SMART
low complexity region 402 415 N/A INTRINSIC
FF 454 507 4.57e-12 SMART
FF 520 574 1.53e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162222
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Tcerg1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tcerg1l APN 7 138209804 missense probably damaging 0.99
IGL01402:Tcerg1l APN 7 138259839 missense probably damaging 0.98
IGL01510:Tcerg1l APN 7 138394305 splice site probably benign
IGL01638:Tcerg1l APN 7 138280076 missense probably damaging 1.00
IGL01710:Tcerg1l APN 7 138395060 missense possibly damaging 0.81
IGL02547:Tcerg1l APN 7 138248371 critical splice donor site probably null
IGL02887:Tcerg1l APN 7 138229890 missense probably damaging 1.00
IGL03105:Tcerg1l APN 7 138248444 splice site probably benign
IGL03348:Tcerg1l APN 7 138213371 missense probably damaging 0.97
R0378:Tcerg1l UTSW 7 138276655 missense probably benign 0.01
R1474:Tcerg1l UTSW 7 138280075 missense probably damaging 0.99
R1589:Tcerg1l UTSW 7 138361767 missense probably damaging 0.99
R1658:Tcerg1l UTSW 7 138394180 missense probably damaging 0.98
R1792:Tcerg1l UTSW 7 138361866 missense probably benign 0.07
R1807:Tcerg1l UTSW 7 138395097 missense probably benign 0.34
R2920:Tcerg1l UTSW 7 138248379 missense probably damaging 0.99
R4106:Tcerg1l UTSW 7 138259944 missense probably damaging 0.99
R4180:Tcerg1l UTSW 7 138276676 critical splice acceptor site probably null
R4241:Tcerg1l UTSW 7 138397632 missense unknown
R4898:Tcerg1l UTSW 7 138218057 missense probably damaging 0.99
R5652:Tcerg1l UTSW 7 138280046 missense probably damaging 0.97
R6646:Tcerg1l UTSW 7 138395183 splice site probably null
R6824:Tcerg1l UTSW 7 138394115 critical splice donor site probably null
R7414:Tcerg1l UTSW 7 138218057 missense probably damaging 0.97
R7490:Tcerg1l UTSW 7 138259828 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGCAGTCCTGAACACG -3'
(R):5'- CCCTAGAATGTCTTCACAGTCCAG -3'

Sequencing Primer
(F):5'- TGCAGTCCTGAACACGACTCC -3'
(R):5'- TCTTCACAGTCCAGAAGGGCATG -3'
Posted On2015-02-05