Mutagenetix > Incidental Mutations

Incidental Mutation 'R3148:Col7a1'

264330

Institutional Source

Beutler Lab

Gene Symbol

Col7a1

Ensembl Gene

ENSMUSG00000025650

Gene Name

collagen, type VII, alpha 1

Synonyms

MMRRC Submission

040600-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3148 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108953586-108984875 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108961405 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 974 (T974A)

Ref Sequence

ENSEMBL: ENSMUSP00000107701 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]

Predicted Effect

unknown
Transcript: ENSMUST00000026740
AA Change: T974A

SMART Domains

Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: T974A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
VWA	37	217	1.56e-51	SMART
FN3	233	319	1.41e-10	SMART
FN3	325	405	6.54e-6	SMART
FN3	416	494	6.91e-5	SMART
FN3	509	585	1.24e-6	SMART
FN3	599	675	2.01e-6	SMART
FN3	687	763	7.45e-10	SMART
FN3	774	854	6.01e-5	SMART
FN3	865	944	7.23e-8	SMART
FN3	955	1038	2.16e-6	SMART
Pfam:VWA	1055	1227	2.3e-22	PFAM
Pfam:Collagen	1244	1311	2.4e-8	PFAM
Pfam:Collagen	1294	1355	4.1e-10	PFAM
low complexity region	1397	1414	N/A	INTRINSIC
Pfam:Collagen	1447	1504	1.3e-9	PFAM
Pfam:Collagen	1487	1547	5e-8	PFAM
low complexity region	1572	1595	N/A	INTRINSIC
low complexity region	1604	1632	N/A	INTRINSIC
Pfam:Collagen	1646	1714	2.8e-10	PFAM
Pfam:Collagen	1713	1775	1.9e-10	PFAM
low complexity region	1776	1794	N/A	INTRINSIC
low complexity region	1803	1833	N/A	INTRINSIC
Pfam:Collagen	1875	1935	1.5e-8	PFAM
Pfam:Collagen	1969	2033	2.4e-9	PFAM
Pfam:Collagen	2025	2092	9.1e-10	PFAM
Pfam:Collagen	2089	2158	1.3e-10	PFAM
Pfam:Collagen	2147	2209	1.6e-9	PFAM
Pfam:Collagen	2245	2312	1.4e-8	PFAM
Pfam:Collagen	2313	2365	2.5e-8	PFAM
Pfam:Collagen	2364	2423	7.3e-10	PFAM
Pfam:Collagen	2398	2457	1.5e-9	PFAM
Pfam:Collagen	2456	2515	8.4e-11	PFAM
Pfam:Collagen	2516	2572	1.9e-9	PFAM
Pfam:Collagen	2560	2630	7.2e-9	PFAM
Pfam:Collagen	2605	2682	6e-9	PFAM
Pfam:Collagen	2659	2722	2e-8	PFAM
low complexity region	2745	2775	N/A	INTRINSIC
Pfam:Kunitz_BPTI	2878	2932	3.2e-19	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000112070
AA Change: T974A

SMART Domains

Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: T974A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
VWA	37	217	1.56e-51	SMART
FN3	233	319	1.41e-10	SMART
FN3	325	405	6.54e-6	SMART
FN3	416	494	6.91e-5	SMART
FN3	509	585	1.24e-6	SMART
FN3	599	675	2.01e-6	SMART
FN3	687	763	7.45e-10	SMART
FN3	774	854	6.01e-5	SMART
FN3	865	944	7.23e-8	SMART
FN3	955	1038	2.16e-6	SMART
Pfam:VWA	1055	1230	2.2e-19	PFAM
Pfam:Collagen	1244	1311	2.5e-8	PFAM
Pfam:Collagen	1294	1355	4.2e-10	PFAM
low complexity region	1397	1414	N/A	INTRINSIC
Pfam:Collagen	1447	1504	1.3e-9	PFAM
Pfam:Collagen	1487	1547	5.1e-8	PFAM
low complexity region	1572	1595	N/A	INTRINSIC
low complexity region	1604	1632	N/A	INTRINSIC
Pfam:Collagen	1646	1714	2.9e-10	PFAM
Pfam:Collagen	1713	1775	1.9e-10	PFAM
low complexity region	1776	1794	N/A	INTRINSIC
low complexity region	1803	1833	N/A	INTRINSIC
Pfam:Collagen	1875	1935	1.5e-8	PFAM
Pfam:Collagen	1969	2033	2.5e-9	PFAM
Pfam:Collagen	2025	2092	9.4e-10	PFAM
Pfam:Collagen	2089	2158	1.3e-10	PFAM
Pfam:Collagen	2147	2209	1.6e-9	PFAM
Pfam:Collagen	2195	2266	7.7e-7	PFAM
Pfam:Collagen	2245	2312	1.4e-8	PFAM
Pfam:Collagen	2313	2365	2.6e-8	PFAM
Pfam:Collagen	2364	2423	7.6e-10	PFAM
Pfam:Collagen	2398	2457	1.5e-9	PFAM
Pfam:Collagen	2456	2515	8.7e-11	PFAM
Pfam:Collagen	2516	2572	2e-9	PFAM
Pfam:Collagen	2560	2630	7.4e-9	PFAM
Pfam:Collagen	2605	2682	6.2e-9	PFAM
Pfam:Collagen	2659	2722	2.1e-8	PFAM
Pfam:Collagen	2719	2778	1.6e-7	PFAM
Pfam:Kunitz_BPTI	2878	2932	1.1e-19	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.6%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	C	X: 67,921,378	D12G	probably benign	Het
Adamts18	C	A	8: 113,738,858	V701L	probably damaging	Het
Alg2	A	T	4: 47,472,259	V183D	probably damaging	Het
Ank2	T	C	3: 126,933,075	I857V	probably benign	Het
Asb15	G	T	6: 24,566,259	A404S	probably damaging	Het
Baalc	A	T	15: 38,949,173	E106V	possibly damaging	Het
Catsperd	G	T	17: 56,664,039	C701F	possibly damaging	Het
Cc2d2a	T	A	5: 43,709,155	I769N	probably damaging	Het
Cntnap4	A	G	8: 112,757,439	T375A	probably damaging	Het
Ehbp1	T	C	11: 22,100,465	Y502C	probably damaging	Het
Gm13083	A	T	4: 143,617,477	D449V	probably benign	Het
Kcnj11	C	T	7: 46,099,120	V260I	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Marf1	A	G	16: 14,125,979	V1380A	possibly damaging	Het
Olfr1280	T	C	2: 111,316,288	F270L	possibly damaging	Het
Otog	T	C	7: 46,290,169	L2124P	probably damaging	Het
Pam	T	A	1: 97,895,678	N256I	possibly damaging	Het
Pcbp1	C	T	6: 86,525,489	E143K	probably damaging	Het
Prrx1	T	C	1: 163,257,848	D171G	probably benign	Het
Rasal2	A	T	1: 157,243,764		probably benign	Het
Serpinb5	T	A	1: 106,881,825	H320Q	probably damaging	Het
Snx4	A	C	16: 33,287,724	D296A	probably benign	Het
Sorcs2	T	C	5: 36,035,788	Q778R	probably benign	Het
Spata16	T	C	3: 26,878,712		probably null	Het
Tcerg1l	G	T	7: 138,259,867	Q378K	probably benign	Het
Trpm1	T	C	7: 64,235,012	Y814H	probably benign	Het

Other mutations in Col7a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Col7a1	APN	9	108977697	nonsense	probably null
IGL01366:Col7a1	APN	9	108977119	splice site	probably benign
IGL01395:Col7a1	APN	9	108983912	unclassified	probably benign
IGL01410:Col7a1	APN	9	108964618	missense	unknown
IGL01902:Col7a1	APN	9	108977827	missense	unknown
IGL01915:Col7a1	APN	9	108955745	missense	unknown
IGL01936:Col7a1	APN	9	108967999	splice site	probably benign
IGL01943:Col7a1	APN	9	108984016	critical splice acceptor site	probably null
IGL02026:Col7a1	APN	9	108968029	missense	probably damaging	1.00
IGL02168:Col7a1	APN	9	108984075	unclassified	probably benign
IGL02504:Col7a1	APN	9	108980675	missense	unknown
IGL02510:Col7a1	APN	9	108973231	splice site	probably benign
IGL02559:Col7a1	APN	9	108973216	missense	unknown
IGL02583:Col7a1	APN	9	108962229	missense	unknown
IGL02728:Col7a1	APN	9	108984104	missense	probably benign	0.39
IGL03003:Col7a1	APN	9	108974956	critical splice donor site	probably null
IGL03096:Col7a1	APN	9	108955788	missense	unknown
IGL03122:Col7a1	APN	9	108961683	missense	unknown
IGL03212:Col7a1	APN	9	108974452	missense	unknown
IGL03240:Col7a1	APN	9	108968373	missense	probably null	1.00
IGL03355:Col7a1	APN	9	108978160	missense	unknown
olivetti	UTSW	9	108969961	missense	probably damaging	1.00
smallified	UTSW	9	108972813	critical splice donor site	probably null
underwood	UTSW	9	108968875	critical splice acceptor site	probably null
PIT4131001:Col7a1	UTSW	9	108965921	splice site	probably benign
R0007:Col7a1	UTSW	9	108961403	missense	unknown
R0007:Col7a1	UTSW	9	108961403	missense	unknown
R0078:Col7a1	UTSW	9	108974913	splice site	probably benign
R0091:Col7a1	UTSW	9	108967506	splice site	probably benign
R0126:Col7a1	UTSW	9	108969583	splice site	probably benign
R0244:Col7a1	UTSW	9	108972184	splice site	probably null
R0331:Col7a1	UTSW	9	108967502	splice site	probably benign
R0375:Col7a1	UTSW	9	108980237	missense	unknown
R0601:Col7a1	UTSW	9	108980584	splice site	probably benign
R0609:Col7a1	UTSW	9	108958147	missense	unknown
R0709:Col7a1	UTSW	9	108961548	splice site	probably benign
R0879:Col7a1	UTSW	9	108976091	splice site	probably benign
R1175:Col7a1	UTSW	9	108955334	missense	unknown
R1177:Col7a1	UTSW	9	108962441	missense	unknown
R1435:Col7a1	UTSW	9	108963273	missense	unknown
R1497:Col7a1	UTSW	9	108978825	missense	unknown
R1549:Col7a1	UTSW	9	108955966	missense	unknown
R1794:Col7a1	UTSW	9	108965928	missense	unknown
R1801:Col7a1	UTSW	9	108960997	missense	unknown
R1848:Col7a1	UTSW	9	108969565	missense	possibly damaging	0.83
R1899:Col7a1	UTSW	9	108978888	missense	unknown
R1944:Col7a1	UTSW	9	108960010	missense	unknown
R1945:Col7a1	UTSW	9	108960010	missense	unknown
R1955:Col7a1	UTSW	9	108955664	missense	unknown
R2009:Col7a1	UTSW	9	108968875	critical splice acceptor site	probably null
R2034:Col7a1	UTSW	9	108963007	missense	unknown
R3713:Col7a1	UTSW	9	108964440	nonsense	probably null
R4078:Col7a1	UTSW	9	108960991	missense	unknown
R4193:Col7a1	UTSW	9	108956672	missense	unknown
R4232:Col7a1	UTSW	9	108972813	critical splice donor site	probably null
R4528:Col7a1	UTSW	9	108959533	missense	unknown
R4771:Col7a1	UTSW	9	108971925	missense	probably damaging	0.99
R4820:Col7a1	UTSW	9	108968607	missense	possibly damaging	0.72
R4896:Col7a1	UTSW	9	108957277	missense	unknown
R4911:Col7a1	UTSW	9	108975219	missense	unknown
R4915:Col7a1	UTSW	9	108966464	missense	unknown
R4917:Col7a1	UTSW	9	108966464	missense	unknown
R5001:Col7a1	UTSW	9	108965078	critical splice donor site	probably null
R5352:Col7a1	UTSW	9	108961411	missense	unknown
R5361:Col7a1	UTSW	9	108963224	missense	unknown
R5730:Col7a1	UTSW	9	108972242	critical splice donor site	probably null
R5838:Col7a1	UTSW	9	108978143	missense	unknown
R5842:Col7a1	UTSW	9	108965815	missense	unknown
R5932:Col7a1	UTSW	9	108980211	missense	unknown
R6091:Col7a1	UTSW	9	108955334	missense	unknown
R6144:Col7a1	UTSW	9	108974080	missense	unknown
R6158:Col7a1	UTSW	9	108964603	missense	unknown
R6170:Col7a1	UTSW	9	108966443	missense	unknown
R6247:Col7a1	UTSW	9	108981062	unclassified	probably benign
R6338:Col7a1	UTSW	9	108956633	missense	unknown
R6339:Col7a1	UTSW	9	108956633	missense	unknown
R6382:Col7a1	UTSW	9	108975393	missense	unknown
R6518:Col7a1	UTSW	9	108955527	missense	unknown
R6533:Col7a1	UTSW	9	108961358	missense	unknown
R6569:Col7a1	UTSW	9	108978110	splice site	probably null
R6596:Col7a1	UTSW	9	108954341	unclassified	probably benign
R6697:Col7a1	UTSW	9	108970533	missense	probably damaging	1.00
R6753:Col7a1	UTSW	9	108958128	missense	unknown
R6849:Col7a1	UTSW	9	108975053	missense	unknown
R6915:Col7a1	UTSW	9	108967618	missense	probably benign	0.02
R6974:Col7a1	UTSW	9	108969426	missense	possibly damaging	0.82
R6991:Col7a1	UTSW	9	108983919	critical splice donor site	probably null
R7028:Col7a1	UTSW	9	108963263	nonsense	probably null
R7556:Col7a1	UTSW	9	108982465	splice site	probably null
R7571:Col7a1	UTSW	9	108982707	missense	probably null
R7815:Col7a1	UTSW	9	108969565	missense	probably damaging	0.96
R7875:Col7a1	UTSW	9	108958695	missense	unknown
R7931:Col7a1	UTSW	9	108980522	splice site	probably benign
R8016:Col7a1	UTSW	9	108958644	missense	unknown
R8038:Col7a1	UTSW	9	108957292	missense	unknown
R8049:Col7a1	UTSW	9	108975563	missense	unknown
R8098:Col7a1	UTSW	9	108956695	missense	unknown
R8103:Col7a1	UTSW	9	108975384	missense	unknown
R8128:Col7a1	UTSW	9	108955721	missense	unknown
R8268:Col7a1	UTSW	9	108972989	missense	unknown
R8274:Col7a1	UTSW	9	108969961	missense	probably damaging	1.00
R8318:Col7a1	UTSW	9	108958374	missense	unknown
RF008:Col7a1	UTSW	9	108964479	missense	unknown
X0023:Col7a1	UTSW	9	108984185	unclassified	probably benign
Z1088:Col7a1	UTSW	9	108978500	splice site	silent
Z1177:Col7a1	UTSW	9	108974923	missense	unknown
Z1177:Col7a1	UTSW	9	108976051	missense	unknown
Z1177:Col7a1	UTSW	9	108984077	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAGTGATCTCCCAGGATGCTTC -3'
(R):5'- GGAAATACCAGGTTCCAGCC -3'

Sequencing Primer
(F):5'- TCTCCCAGGATGCTTCACTAAAATG -3'
(R):5'- AATACCAGGTTCCAGCCCTGTC -3'

Posted On

2015-02-05