Incidental Mutation 'R3148:Baalc'
ID264334
Institutional Source Beutler Lab
Gene Symbol Baalc
Ensembl Gene ENSMUSG00000022296
Gene Namebrain and acute leukemia, cytoplasmic
Synonyms
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location38933144-38952912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38949173 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 106 (E106V)
Ref Sequence ENSEMBL: ENSMUSP00000132788 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000163313
AA Change: E106V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181362
Predicted Effect possibly damaging
Transcript: ENSMUST00000226440
AA Change: E75V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by gene expression studies in patients with acute myeloid leukemia (AML). The gene is conserved among mammals and is not found in lower organisms. Tissues that express this gene develop from the neuroectoderm. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene; however, some of the transcript variants are found only in AML cell lines. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Baalc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0492:Baalc UTSW 15 38934085 splice site probably benign
R2051:Baalc UTSW 15 38933234 unclassified probably benign
R3147:Baalc UTSW 15 38949173 missense possibly damaging 0.92
R4821:Baalc UTSW 15 38933180 unclassified probably benign
R7807:Baalc UTSW 15 38934017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCTTCGTGGAGCATTAAAAC -3'
(R):5'- ATGTTCGTCACAGCGTTGG -3'

Sequencing Primer
(F):5'- ACCTGGCCTTATATGCATGAG -3'
(R):5'- TCACAGCGTTGGGTGGC -3'
Posted On2015-02-05