Incidental Mutation 'R3148:Snx4'
ID264336
Institutional Source Beutler Lab
Gene Symbol Snx4
Ensembl Gene ENSMUSG00000022808
Gene Namesorting nexin 4
Synonyms
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R3148 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33251442-33300269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 33287724 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 296 (D296A)
Ref Sequence ENSEMBL: ENSMUSP00000023502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023502] [ENSMUST00000231389]
Predicted Effect probably benign
Transcript: ENSMUST00000023502
AA Change: D296A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023502
Gene: ENSMUSG00000022808
AA Change: D296A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
PX 56 184 1.86e-34 SMART
low complexity region 237 248 N/A INTRINSIC
coiled coil region 369 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231389
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associated with the long isoform of the leptin receptor and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor in cell cultures, but its function is unknown. This protein may form oligomeric complexes with family members. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T C X: 67,921,378 D12G probably benign Het
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in Snx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Snx4 APN 16 33264254 splice site probably benign
IGL01831:Snx4 APN 16 33284422 nonsense probably null
IGL02069:Snx4 APN 16 33264355 missense probably damaging 1.00
IGL03204:Snx4 APN 16 33269669 missense probably benign 0.01
R1336:Snx4 UTSW 16 33280680 missense probably benign 0.20
R1613:Snx4 UTSW 16 33286046 missense probably damaging 1.00
R1901:Snx4 UTSW 16 33284438 missense possibly damaging 0.95
R2177:Snx4 UTSW 16 33286058 splice site probably null
R3147:Snx4 UTSW 16 33287724 missense probably benign 0.08
R4380:Snx4 UTSW 16 33264296 missense probably damaging 1.00
R4924:Snx4 UTSW 16 33294730 missense probably benign 0.04
R6889:Snx4 UTSW 16 33251470 missense possibly damaging 0.89
R6904:Snx4 UTSW 16 33294738 missense probably damaging 0.97
R7355:Snx4 UTSW 16 33266866 missense probably damaging 1.00
R7937:Snx4 UTSW 16 33291829 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGACATGCCCGGTGTG -3'
(R):5'- TACACAGAAAATTAGCCAAAGTGTG -3'

Sequencing Primer
(F):5'- TGTGTGAACGATATGACATGCCC -3'
(R):5'- TGGCTACACTGGGGCCTC -3'
Posted On2015-02-05