Incidental Mutation 'R3148:4933436I01Rik'
ID264338
Institutional Source Beutler Lab
Gene Symbol 4933436I01Rik
Ensembl Gene ENSMUSG00000025288
Gene NameRIKEN cDNA 4933436I01 gene
Synonyms
MMRRC Submission 040600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3148 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location67919864-67921450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67921378 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000026325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026325]
Predicted Effect probably benign
Transcript: ENSMUST00000026325
AA Change: D12G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000026325
Gene: ENSMUSG00000025288
AA Change: D12G

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
internal_repeat_1 172 240 2.42e-18 PROSPERO
internal_repeat_1 280 348 2.42e-18 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,738,858 V701L probably damaging Het
Alg2 A T 4: 47,472,259 V183D probably damaging Het
Ank2 T C 3: 126,933,075 I857V probably benign Het
Asb15 G T 6: 24,566,259 A404S probably damaging Het
Baalc A T 15: 38,949,173 E106V possibly damaging Het
Catsperd G T 17: 56,664,039 C701F possibly damaging Het
Cc2d2a T A 5: 43,709,155 I769N probably damaging Het
Cntnap4 A G 8: 112,757,439 T375A probably damaging Het
Col7a1 A G 9: 108,961,405 T974A unknown Het
Ehbp1 T C 11: 22,100,465 Y502C probably damaging Het
Gm13083 A T 4: 143,617,477 D449V probably benign Het
Kcnj11 C T 7: 46,099,120 V260I probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Marf1 A G 16: 14,125,979 V1380A possibly damaging Het
Olfr1280 T C 2: 111,316,288 F270L possibly damaging Het
Otog T C 7: 46,290,169 L2124P probably damaging Het
Pam T A 1: 97,895,678 N256I possibly damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Prrx1 T C 1: 163,257,848 D171G probably benign Het
Rasal2 A T 1: 157,243,764 probably benign Het
Serpinb5 T A 1: 106,881,825 H320Q probably damaging Het
Snx4 A C 16: 33,287,724 D296A probably benign Het
Sorcs2 T C 5: 36,035,788 Q778R probably benign Het
Spata16 T C 3: 26,878,712 probably null Het
Tcerg1l G T 7: 138,259,867 Q378K probably benign Het
Trpm1 T C 7: 64,235,012 Y814H probably benign Het
Other mutations in 4933436I01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:4933436I01Rik APN X 67920604 missense possibly damaging 0.90
R1974:4933436I01Rik UTSW X 67920049 nonsense probably null
R2062:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2063:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2064:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2065:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2066:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R2068:4933436I01Rik UTSW X 67920702 missense probably benign 0.01
R3147:4933436I01Rik UTSW X 67921378 missense probably benign 0.06
Z1177:4933436I01Rik UTSW X 67920992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGGCTTTCTAGGGTG -3'
(R):5'- ACCATTCACCAAGGGCTCAG -3'

Sequencing Primer
(F):5'- TGGGTTGAACAGGGAGTTTAAGC -3'
(R):5'- GCATACATTGTGATGTCAGAGCC -3'
Posted On2015-02-05