Incidental Mutation 'R3149:Gm5150'
ID264342
Institutional Source Beutler Lab
Gene Symbol Gm5150
Ensembl Gene ENSMUSG00000078780
Gene Namepredicted gene 5150
Synonyms
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location15946870-16006437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16006315 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 3 (L3P)
Ref Sequence ENSEMBL: ENSMUSP00000141397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108347] [ENSMUST00000194367]
Predicted Effect probably damaging
Transcript: ENSMUST00000108347
AA Change: L3P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103984
Gene: ENSMUSG00000078780
AA Change: L3P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 8.78e-9 SMART
IG 156 262 7.52e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194367
AA Change: L3P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141397
Gene: ENSMUSG00000078780
AA Change: L3P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 8.78e-9 SMART
IG 156 262 7.52e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Gm5150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02188:Gm5150 APN 3 15963662 missense possibly damaging 0.95
IGL02485:Gm5150 APN 3 15990752 missense probably damaging 1.00
IGL02507:Gm5150 APN 3 15963321 missense probably damaging 0.97
R1760:Gm5150 UTSW 3 16006304 missense probably benign 0.00
R2081:Gm5150 UTSW 3 15990945 missense probably benign 0.29
R3080:Gm5150 UTSW 3 15990921 missense possibly damaging 0.93
R5329:Gm5150 UTSW 3 15963424 missense probably benign 0.35
R5627:Gm5150 UTSW 3 15963400 missense probably damaging 1.00
R6052:Gm5150 UTSW 3 15990753 missense probably damaging 1.00
R6455:Gm5150 UTSW 3 15990651 missense probably damaging 1.00
R6963:Gm5150 UTSW 3 16006391 start gained probably benign
R7688:Gm5150 UTSW 3 15963583 missense probably benign 0.07
R7872:Gm5150 UTSW 3 16006321 start codon destroyed probably null 0.37
R8368:Gm5150 UTSW 3 15990738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGCTGTGACAGTTCAGG -3'
(R):5'- TGTTACGCACATTTGAGTCCC -3'

Sequencing Primer
(F):5'- CTGTGACAGTTCAGGTAATTAACTGG -3'
(R):5'- TAGGAACTCCTTCCCAGCAG -3'
Posted On2015-02-05