Incidental Mutation 'R3149:Rmnd5a'
ID264348
Institutional Source Beutler Lab
Gene Symbol Rmnd5a
Ensembl Gene ENSMUSG00000002222
Gene Namerequired for meiotic nuclear division 5 homolog A
Synonyms1110007A06Rik, Gid2
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71388634-71440637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71429101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 68 (I68L)
Ref Sequence ENSEMBL: ENSMUSP00000002292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002292]
Predicted Effect probably benign
Transcript: ENSMUST00000002292
AA Change: I68L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000002292
Gene: ENSMUSG00000002222
AA Change: I68L

DomainStartEndE-ValueType
LisH 114 146 5.54e-5 SMART
CTLH 153 210 9.86e-11 SMART
CRA 208 302 7.07e-17 SMART
Pfam:zf-RING_UBOX 336 375 3.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Rmnd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02892:Rmnd5a APN 6 71414814 missense probably benign 0.00
IGL03264:Rmnd5a APN 6 71393135 missense probably damaging 0.99
R0046:Rmnd5a UTSW 6 71399231 missense probably damaging 0.98
R0046:Rmnd5a UTSW 6 71399231 missense probably damaging 0.98
R1295:Rmnd5a UTSW 6 71398455 missense probably benign 0.45
R1296:Rmnd5a UTSW 6 71398455 missense probably benign 0.45
R1840:Rmnd5a UTSW 6 71398455 missense probably benign 0.45
R3735:Rmnd5a UTSW 6 71396862 missense possibly damaging 0.75
R3736:Rmnd5a UTSW 6 71396862 missense possibly damaging 0.75
R4459:Rmnd5a UTSW 6 71396881 missense probably damaging 0.98
R4532:Rmnd5a UTSW 6 71399125 critical splice donor site probably null
R4782:Rmnd5a UTSW 6 71413349 missense probably damaging 0.98
R5587:Rmnd5a UTSW 6 71394619 splice site probably benign
R6442:Rmnd5a UTSW 6 71394675 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAAAGGCTCCTCTGTGGTTG -3'
(R):5'- CGTGCTTCAAGGAAGATACTGG -3'

Sequencing Primer
(F):5'- TGATGACCTGAGTTCAATCCCAGG -3'
(R):5'- GCTTCAAGGAAGATACTGGTTTTCC -3'
Posted On2015-02-05