Incidental Mutation 'R3149:Vmn1r86'
ID264349
Institutional Source Beutler Lab
Gene Symbol Vmn1r86
Ensembl Gene ENSMUSG00000070816
Gene Namevomeronasal 1 receptor 86
SynonymsGm10301
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location13097531-13119917 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13102431 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 123 (K123*)
Ref Sequence ENSEMBL: ENSMUSP00000154464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094828] [ENSMUST00000226604] [ENSMUST00000227220] [ENSMUST00000227700]
Predicted Effect probably null
Transcript: ENSMUST00000094828
AA Change: K173*
SMART Domains Protein: ENSMUSP00000092423
Gene: ENSMUSG00000070816
AA Change: K173*

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 1.1e-14 PFAM
Pfam:V1R 35 301 4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210729
Predicted Effect probably null
Transcript: ENSMUST00000226604
AA Change: K173*
Predicted Effect probably null
Transcript: ENSMUST00000227220
AA Change: K173*
Predicted Effect probably null
Transcript: ENSMUST00000227700
AA Change: K123*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Vmn1r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Vmn1r86 APN 7 13102541 missense possibly damaging 0.91
IGL01124:Vmn1r86 APN 7 13102929 missense probably benign 0.04
IGL01291:Vmn1r86 APN 7 13102506 missense probably benign 0.14
IGL02347:Vmn1r86 APN 7 13102647 missense probably damaging 0.99
IGL02457:Vmn1r86 APN 7 13102780 missense probably benign
IGL02983:Vmn1r86 APN 7 13102814 missense probably damaging 1.00
ANU05:Vmn1r86 UTSW 7 13102506 missense probably benign 0.14
R0304:Vmn1r86 UTSW 7 13102780 missense probably benign
R0525:Vmn1r86 UTSW 7 13102161 missense probably benign 0.13
R1958:Vmn1r86 UTSW 7 13102694 missense possibly damaging 0.94
R2227:Vmn1r86 UTSW 7 13102920 missense probably benign 0.00
R3896:Vmn1r86 UTSW 7 13102166 missense probably benign 0.18
R4735:Vmn1r86 UTSW 7 13102294 missense probably damaging 1.00
R5219:Vmn1r86 UTSW 7 13102455 missense probably damaging 1.00
R6003:Vmn1r86 UTSW 7 13102198 nonsense probably null
R6457:Vmn1r86 UTSW 7 13102352 missense possibly damaging 0.70
R7442:Vmn1r86 UTSW 7 13102056 missense possibly damaging 0.70
R7622:Vmn1r86 UTSW 7 13102758 missense probably benign 0.07
R8436:Vmn1r86 UTSW 7 13102844 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AACAGGATGCTGTGAGTGGC -3'
(R):5'- TAAGCACGTTCCAAGTCATCAC -3'

Sequencing Primer
(F):5'- CTTTGCGCTCAGGAGATGGC -3'
(R):5'- TCCCAGTAACTCTAAGTGGGC -3'
Posted On2015-02-05