Incidental Mutation 'R3149:Rassf9'
ID264359
Institutional Source Beutler Lab
Gene Symbol Rassf9
Ensembl Gene ENSMUSG00000044921
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 9
SynonymsPamci
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location102512222-102549736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102544826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 21 (D21V)
Ref Sequence ENSEMBL: ENSMUSP00000054767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055355] [ENSMUST00000219445]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055355
AA Change: D21V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054767
Gene: ENSMUSG00000044921
AA Change: D21V

DomainStartEndE-ValueType
RA 23 119 5.33e-18 SMART
coiled coil region 261 291 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219445
AA Change: D23V

PolyPhen 2 Score 0.745 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to perinuclear endosomes. This protein associates with peptidylglycine alpha-amidating monooxygenase, and may be involved with the trafficking of this enzyme through secretory or endosomal pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature lethality, alopecia, lung defects, and abnormal skin morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Rassf9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Rassf9 APN 10 102545633 missense probably benign 0.04
IGL02396:Rassf9 APN 10 102545693 missense possibly damaging 0.74
IGL02714:Rassf9 APN 10 102512563 missense possibly damaging 0.85
IGL02987:Rassf9 APN 10 102545248 missense possibly damaging 0.60
IGL03376:Rassf9 APN 10 102545198 missense probably damaging 0.96
R0372:Rassf9 UTSW 10 102546011 missense possibly damaging 0.71
R0377:Rassf9 UTSW 10 102545649 missense probably benign 0.00
R1260:Rassf9 UTSW 10 102512585 critical splice donor site probably null
R1481:Rassf9 UTSW 10 102546034 missense probably benign 0.01
R1563:Rassf9 UTSW 10 102544960 missense probably damaging 0.97
R1894:Rassf9 UTSW 10 102544894 missense possibly damaging 0.92
R1913:Rassf9 UTSW 10 102544939 missense probably benign 0.04
R2115:Rassf9 UTSW 10 102544945 missense probably benign 0.02
R5072:Rassf9 UTSW 10 102545905 missense probably damaging 0.98
R5282:Rassf9 UTSW 10 102545344 missense probably damaging 1.00
R5804:Rassf9 UTSW 10 102545044 missense probably damaging 1.00
R6296:Rassf9 UTSW 10 102545753 missense probably damaging 1.00
R6662:Rassf9 UTSW 10 102546038 missense possibly damaging 0.90
R7719:Rassf9 UTSW 10 102545600 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTCTTCCATAACGAGCTAC -3'
(R):5'- CCACTTTTCTACGATGCAGTAGTC -3'

Sequencing Primer
(F):5'- GTCTCTTCCATAACGAGCTACAAATG -3'
(R):5'- GCCTGGATAACATCGATG -3'
Posted On2015-02-05