Incidental Mutation 'R3149:Gm11492'
ID264362
Institutional Source Beutler Lab
Gene Symbol Gm11492
Ensembl Gene ENSMUSG00000090107
Gene Namepredicted gene 11492
Synonyms
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87566653-87569250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87567244 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 148 (V148A)
Ref Sequence ENSEMBL: ENSMUSP00000053087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060360] [ENSMUST00000122945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060360
AA Change: V148A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053087
Gene: ENSMUSG00000090107
AA Change: V148A

DomainStartEndE-ValueType
Pfam:DUF4655 13 369 1.7e-99 PFAM
Pfam:DUF4655 366 509 2.7e-68 PFAM
low complexity region 511 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Gm11492
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gm11492 APN 11 87568249 missense probably benign 0.07
IGL01993:Gm11492 APN 11 87567729 missense possibly damaging 0.85
IGL02566:Gm11492 APN 11 87567642 missense probably benign 0.00
IGL03213:Gm11492 APN 11 87567358 splice site probably null
IGL03388:Gm11492 APN 11 87568216 nonsense probably null
R0050:Gm11492 UTSW 11 87567346 missense probably damaging 1.00
R1479:Gm11492 UTSW 11 87567418 missense probably damaging 1.00
R1851:Gm11492 UTSW 11 87568915 missense probably damaging 1.00
R1862:Gm11492 UTSW 11 87567235 missense possibly damaging 0.48
R1913:Gm11492 UTSW 11 87567012 missense probably benign
R3176:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R3276:Gm11492 UTSW 11 87567244 missense possibly damaging 0.46
R4021:Gm11492 UTSW 11 87567280 missense probably damaging 1.00
R4117:Gm11492 UTSW 11 87568282 missense probably damaging 1.00
R4332:Gm11492 UTSW 11 87567904 missense possibly damaging 0.95
R4515:Gm11492 UTSW 11 87568057 missense probably benign
R4663:Gm11492 UTSW 11 87567603 missense probably damaging 0.98
R4952:Gm11492 UTSW 11 87567772 missense probably benign 0.00
R5015:Gm11492 UTSW 11 87567217 missense possibly damaging 0.95
R5176:Gm11492 UTSW 11 87567532 missense probably benign 0.02
R5711:Gm11492 UTSW 11 87567897 missense probably benign 0.07
R6305:Gm11492 UTSW 11 87567319 missense probably benign 0.00
T0970:Gm11492 UTSW 11 87567732 missense probably damaging 0.98
Z1177:Gm11492 UTSW 11 87567922 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGACTACCTACACCCTGTG -3'
(R):5'- ATGCTGAAATCCTACGGGGTAC -3'

Sequencing Primer
(F):5'- TGTGTCCCCACAGCCAG -3'
(R):5'- CTGAAATCCTACGGGGTACTTTAACC -3'
Posted On2015-02-05