Incidental Mutation 'R3149:Mrc2'
ID 264364
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Name mannose receptor, C type 2
Synonyms Endo180, uPARAP, novel lectin
MMRRC Submission 040601-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3149 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 105183469-105241965 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 105239257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
AlphaFold Q64449
Predicted Effect probably benign
Transcript: ENSMUST00000021038
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100335
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 G A 17: 57,183,348 (GRCm39) A30T probably benign Het
Atox1 A G 11: 55,341,379 (GRCm39) L52P possibly damaging Het
Cel T C 2: 28,446,143 (GRCm39) D576G probably benign Het
Csf2ra C A 19: 61,215,758 (GRCm39) A16S possibly damaging Het
Cyp4f18 T C 8: 72,747,044 (GRCm39) D317G possibly damaging Het
Dus1l T C 11: 120,683,930 (GRCm39) T173A possibly damaging Het
Dzip1 T C 14: 119,148,780 (GRCm39) T300A probably benign Het
Ggta1 A T 2: 35,292,635 (GRCm39) I224N probably damaging Het
Gm5150 A G 3: 16,060,479 (GRCm39) L3P probably damaging Het
Gm5592 A G 7: 40,937,804 (GRCm39) E362G probably benign Het
Gm7137 T C 10: 77,623,839 (GRCm39) probably benign Het
Gpatch2l A G 12: 86,291,089 (GRCm39) T91A possibly damaging Het
Hoxa13 G T 6: 52,237,284 (GRCm39) probably benign Het
Ift46 A G 9: 44,695,045 (GRCm39) D65G probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Mapk11 T C 15: 89,029,653 (GRCm39) probably null Het
Mettl25 T C 10: 105,662,214 (GRCm39) D252G probably benign Het
Or10ab4 C T 7: 107,654,989 (GRCm39) R267C probably benign Het
Pecam1 A G 11: 106,575,107 (GRCm39) V601A possibly damaging Het
Prkx A T X: 76,814,881 (GRCm39) F260I probably damaging Het
Rassf9 A T 10: 102,380,687 (GRCm39) D21V possibly damaging Het
Rmnd5a T A 6: 71,406,085 (GRCm39) I68L probably benign Het
Rock2 T C 12: 17,015,092 (GRCm39) S762P probably damaging Het
Septin4 T C 11: 87,458,070 (GRCm39) V148A possibly damaging Het
Srgap2 T C 1: 131,220,327 (GRCm39) T216A probably benign Het
Tasor2 G A 13: 3,624,359 (GRCm39) P1182S probably damaging Het
Vmn1r86 T A 7: 12,836,358 (GRCm39) K123* probably null Het
Vmn2r68 A C 7: 84,886,875 (GRCm39) V13G probably benign Het
Vps13d G C 4: 144,853,147 (GRCm39) N2322K possibly damaging Het
Xpo5 A G 17: 46,553,173 (GRCm39) probably null Het
Zswim9 T C 7: 13,011,196 (GRCm39) T51A possibly damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105,219,567 (GRCm39) missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105,238,469 (GRCm39) nonsense probably null
IGL01751:Mrc2 APN 11 105,216,560 (GRCm39) missense probably benign 0.00
IGL01780:Mrc2 APN 11 105,216,547 (GRCm39) missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105,227,503 (GRCm39) missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105,216,547 (GRCm39) missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105,216,547 (GRCm39) missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105,227,533 (GRCm39) missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105,224,446 (GRCm39) splice site probably benign
IGL02940:Mrc2 APN 11 105,231,997 (GRCm39) missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105,216,397 (GRCm39) missense probably benign 0.04
R0254:Mrc2 UTSW 11 105,238,692 (GRCm39) missense probably benign 0.00
R0634:Mrc2 UTSW 11 105,238,518 (GRCm39) missense probably benign 0.01
R1102:Mrc2 UTSW 11 105,231,647 (GRCm39) missense probably benign
R1233:Mrc2 UTSW 11 105,239,241 (GRCm39) missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R1458:Mrc2 UTSW 11 105,228,598 (GRCm39) missense probably benign 0.01
R1500:Mrc2 UTSW 11 105,238,551 (GRCm39) missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105,227,482 (GRCm39) missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105,229,619 (GRCm39) missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105,228,546 (GRCm39) missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105,238,682 (GRCm39) splice site probably null
R2165:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2265:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2266:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2267:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2268:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2269:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2270:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2271:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2272:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2296:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2298:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2300:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2326:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2518:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2519:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2520:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R2895:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3029:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3030:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3079:Mrc2 UTSW 11 105,227,539 (GRCm39) missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3150:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3420:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3422:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3441:Mrc2 UTSW 11 105,238,542 (GRCm39) missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3731:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3800:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3820:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3821:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3837:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3838:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3849:Mrc2 UTSW 11 105,183,729 (GRCm39) critical splice donor site probably null
R3850:Mrc2 UTSW 11 105,183,729 (GRCm39) critical splice donor site probably null
R3914:Mrc2 UTSW 11 105,238,058 (GRCm39) splice site probably benign
R3932:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3933:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R3971:Mrc2 UTSW 11 105,218,857 (GRCm39) missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4107:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4113:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4274:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4399:Mrc2 UTSW 11 105,227,484 (GRCm39) nonsense probably null
R4477:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4478:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4493:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4494:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4495:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4547:Mrc2 UTSW 11 105,227,467 (GRCm39) missense probably benign 0.04
R4600:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4601:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4602:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4603:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4610:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4611:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4637:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4672:Mrc2 UTSW 11 105,233,923 (GRCm39) missense probably benign 0.22
R4674:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4675:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4693:Mrc2 UTSW 11 105,234,528 (GRCm39) missense probably benign 0.00
R4706:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4707:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4791:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4792:Mrc2 UTSW 11 105,239,257 (GRCm39) splice site probably null
R4888:Mrc2 UTSW 11 105,232,034 (GRCm39) missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105,234,408 (GRCm39) missense probably benign
R5600:Mrc2 UTSW 11 105,224,492 (GRCm39) missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105,227,040 (GRCm39) nonsense probably null
R5692:Mrc2 UTSW 11 105,227,468 (GRCm39) missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105,223,169 (GRCm39) missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105,228,639 (GRCm39) missense probably benign 0.00
R6140:Mrc2 UTSW 11 105,237,615 (GRCm39) missense probably benign
R6146:Mrc2 UTSW 11 105,216,470 (GRCm39) missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105,237,646 (GRCm39) missense probably benign 0.01
R6437:Mrc2 UTSW 11 105,240,669 (GRCm39) missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105,240,708 (GRCm39) missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105,233,906 (GRCm39) splice site probably null
R6680:Mrc2 UTSW 11 105,216,579 (GRCm39) missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105,219,244 (GRCm39) missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105,239,461 (GRCm39) missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105,223,062 (GRCm39) missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105,216,629 (GRCm39) missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105,220,061 (GRCm39) missense possibly damaging 0.92
R7422:Mrc2 UTSW 11 105,183,609 (GRCm39) start gained probably benign
R7537:Mrc2 UTSW 11 105,183,623 (GRCm39) missense probably benign
R7640:Mrc2 UTSW 11 105,223,121 (GRCm39) missense possibly damaging 0.48
R7709:Mrc2 UTSW 11 105,237,285 (GRCm39) missense probably benign 0.10
R7885:Mrc2 UTSW 11 105,223,092 (GRCm39) missense probably damaging 0.98
R7976:Mrc2 UTSW 11 105,238,829 (GRCm39) missense possibly damaging 0.74
R8042:Mrc2 UTSW 11 105,239,181 (GRCm39) missense probably damaging 0.98
R8096:Mrc2 UTSW 11 105,234,333 (GRCm39) missense probably damaging 1.00
R8353:Mrc2 UTSW 11 105,223,137 (GRCm39) missense probably damaging 0.98
R8453:Mrc2 UTSW 11 105,223,137 (GRCm39) missense probably damaging 0.98
R8519:Mrc2 UTSW 11 105,238,132 (GRCm39) missense possibly damaging 0.62
R8771:Mrc2 UTSW 11 105,240,596 (GRCm39) missense probably benign
R8787:Mrc2 UTSW 11 105,238,465 (GRCm39) missense probably benign
R8925:Mrc2 UTSW 11 105,216,334 (GRCm39) missense probably benign 0.00
R8927:Mrc2 UTSW 11 105,216,334 (GRCm39) missense probably benign 0.00
R8991:Mrc2 UTSW 11 105,229,740 (GRCm39) missense probably benign
R9017:Mrc2 UTSW 11 105,216,711 (GRCm39) missense probably damaging 1.00
R9096:Mrc2 UTSW 11 105,231,398 (GRCm39) missense probably damaging 1.00
R9097:Mrc2 UTSW 11 105,231,398 (GRCm39) missense probably damaging 1.00
R9223:Mrc2 UTSW 11 105,220,093 (GRCm39) missense probably damaging 1.00
R9471:Mrc2 UTSW 11 105,234,559 (GRCm39) missense probably benign 0.03
R9531:Mrc2 UTSW 11 105,240,731 (GRCm39) missense possibly damaging 0.82
T0970:Mrc2 UTSW 11 105,238,453 (GRCm39) missense probably benign 0.41
X0004:Mrc2 UTSW 11 105,238,453 (GRCm39) missense probably benign 0.41
X0062:Mrc2 UTSW 11 105,238,301 (GRCm39) critical splice donor site probably null
Z1176:Mrc2 UTSW 11 105,238,186 (GRCm39) nonsense probably null
Z1176:Mrc2 UTSW 11 105,232,202 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGCACTTGAGCTGCCAGAG -3'
(R):5'- TGTGGAAGGAACCCATTGG -3'

Sequencing Primer
(F):5'- GGTCTATCACCATAAGGAGAATCTGC -3'
(R):5'- CCATTGGGAAGGTGTGGGAATG -3'
Posted On 2015-02-05