Incidental Mutation 'R3149:Pecam1'
ID264365
Institutional Source Beutler Lab
Gene Symbol Pecam1
Ensembl Gene ENSMUSG00000020717
Gene Nameplatelet/endothelial cell adhesion molecule 1
SynonymsCd31, PECAM-1
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106654217-106750628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106684281 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 601 (V601A)
Ref Sequence ENSEMBL: ENSMUSP00000067111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068021] [ENSMUST00000080853] [ENSMUST00000103069] [ENSMUST00000106796] [ENSMUST00000183610]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068021
AA Change: V601A

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067111
Gene: ENSMUSG00000020717
AA Change: V601A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
Pfam:Ig_3 122 198 4.2e-4 PFAM
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 718 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080853
AA Change: V601A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079664
Gene: ENSMUSG00000020717
AA Change: V601A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 710 4e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103069
AA Change: V601A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099358
Gene: ENSMUSG00000020717
AA Change: V601A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106796
AA Change: V601A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102408
Gene: ENSMUSG00000020717
AA Change: V601A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 230 311 1.38e2 SMART
IG_like 327 382 2e-1 SMART
Blast:IG_like 405 486 3e-31 BLAST
IG 497 584 5.49e-1 SMART
transmembrane domain 592 614 N/A INTRINSIC
PDB:2KY5|A 676 727 1e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135481
Predicted Effect probably benign
Transcript: ENSMUST00000183610
AA Change: V500A

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138959
Gene: ENSMUSG00000020717
AA Change: V500A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 32 118 3.54e-4 SMART
IG_like 129 210 1.38e2 SMART
IG_like 226 281 2e-1 SMART
Blast:IG_like 304 385 2e-31 BLAST
IG 396 483 5.49e-1 SMART
transmembrane domain 491 513 N/A INTRINSIC
PDB:2KY5|A 575 626 1e-16 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show increased susceptibility to collagen-induced arthritis, impaired lung alveolarization, and enhanced susceptibility to endotoxic shock. Mice homozygous for a gene-trapped allele show altered vasodilation and nitric oxide homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Pecam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pecam1 APN 11 106699798 missense probably damaging 1.00
IGL01914:Pecam1 APN 11 106699867 missense possibly damaging 0.95
IGL02035:Pecam1 APN 11 106695859 missense probably benign 0.43
IGL02124:Pecam1 APN 11 106690981 missense probably damaging 0.98
IGL02487:Pecam1 APN 11 106671780 missense probably damaging 1.00
IGL02576:Pecam1 APN 11 106671774 missense probably damaging 1.00
IGL03101:Pecam1 APN 11 106697351 missense probably damaging 0.99
R1495:Pecam1 UTSW 11 106688856 missense probably damaging 0.96
R1614:Pecam1 UTSW 11 106681079 missense probably benign 0.00
R1628:Pecam1 UTSW 11 106682960 splice site probably null
R1950:Pecam1 UTSW 11 106685203 missense probably damaging 1.00
R1994:Pecam1 UTSW 11 106695937 missense possibly damaging 0.95
R4022:Pecam1 UTSW 11 106655160 missense probably benign 0.00
R4418:Pecam1 UTSW 11 106695922 missense possibly damaging 0.61
R4747:Pecam1 UTSW 11 106684246 missense probably benign 0.29
R4828:Pecam1 UTSW 11 106699808 missense probably damaging 1.00
R5798:Pecam1 UTSW 11 106695832 missense possibly damaging 0.95
R5864:Pecam1 UTSW 11 106684250 nonsense probably null
R5942:Pecam1 UTSW 11 106661983 intron probably benign
R5966:Pecam1 UTSW 11 106691061 missense probably benign 0.44
R6285:Pecam1 UTSW 11 106685239 missense probably benign 0.02
R6519:Pecam1 UTSW 11 106699642 missense probably benign 0.01
R7078:Pecam1 UTSW 11 106688947 missense probably benign 0.06
R7135:Pecam1 UTSW 11 106689031 missense probably damaging 0.99
R7215:Pecam1 UTSW 11 106695919 missense probably benign 0.15
R7574:Pecam1 UTSW 11 106699784 missense probably damaging 1.00
R7795:Pecam1 UTSW 11 106695832 nonsense probably null
R7855:Pecam1 UTSW 11 106671750 missense probably benign 0.00
R8296:Pecam1 UTSW 11 106688919 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTGAGCCGCCAAAGCTTC -3'
(R):5'- CTGAGTACAGAAGCCCTCATG -3'

Sequencing Primer
(F):5'- GCCGCCAAAGCTTCACACC -3'
(R):5'- TCATGGGCAGACACCAAAG -3'
Posted On2015-02-05