Incidental Mutation 'R3149:Dus1l'
ID264366
Institutional Source Beutler Lab
Gene Symbol Dus1l
Ensembl Gene ENSMUSG00000025155
Gene Namedihydrouridine synthase 1-like (S. cerevisiae)
Synonyms1110032N12Rik
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120789201-120796403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120793104 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 173 (T173A)
Ref Sequence ENSEMBL: ENSMUSP00000132516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026151] [ENSMUST00000100134] [ENSMUST00000106133] [ENSMUST00000106135] [ENSMUST00000116305] [ENSMUST00000129955] [ENSMUST00000143139] [ENSMUST00000153678] [ENSMUST00000167023] [ENSMUST00000208737] [ENSMUST00000172809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026151
AA Change: T173A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026151
Gene: ENSMUSG00000025155
AA Change: T173A

DomainStartEndE-ValueType
Pfam:Dus 20 314 5.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100134
SMART Domains Protein: ENSMUSP00000097711
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 4.9e-78 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106133
AA Change: T173A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101739
Gene: ENSMUSG00000025155
AA Change: T173A

DomainStartEndE-ValueType
Pfam:Dus 20 314 8.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106135
AA Change: T173A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101741
Gene: ENSMUSG00000025155
AA Change: T173A

DomainStartEndE-ValueType
Pfam:Dus 20 314 8.5e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116305
SMART Domains Protein: ENSMUSP00000112007
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
Pfam:RPN7 123 305 1.3e-77 PFAM
PINT 356 439 5.77e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125156
Predicted Effect probably benign
Transcript: ENSMUST00000129955
SMART Domains Protein: ENSMUSP00000116619
Gene: ENSMUSG00000025155

DomainStartEndE-ValueType
Pfam:Dus 20 166 5.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142418
Predicted Effect probably benign
Transcript: ENSMUST00000143139
AA Change: T162A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118773
Gene: ENSMUSG00000025155
AA Change: T162A

DomainStartEndE-ValueType
Pfam:Dus 20 194 1.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146008
Predicted Effect probably benign
Transcript: ENSMUST00000153678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156723
Predicted Effect possibly damaging
Transcript: ENSMUST00000167023
AA Change: T173A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132516
Gene: ENSMUSG00000025155
AA Change: T173A

DomainStartEndE-ValueType
Pfam:Dus 20 322 1.6e-75 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208737
Predicted Effect probably benign
Transcript: ENSMUST00000172809
SMART Domains Protein: ENSMUSP00000133855
Gene: ENSMUSG00000025156

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 37 49 N/A INTRINSIC
Pfam:RPN7 162 344 8.8e-77 PFAM
PINT 395 478 5.77e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Dus1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Dus1l APN 11 120793875 missense probably damaging 1.00
IGL01338:Dus1l APN 11 120793092 missense possibly damaging 0.95
IGL01538:Dus1l APN 11 120793079 missense probably damaging 0.98
IGL03220:Dus1l APN 11 120792359 missense probably damaging 1.00
R0076:Dus1l UTSW 11 120792808 unclassified probably benign
R0076:Dus1l UTSW 11 120792808 unclassified probably benign
R0893:Dus1l UTSW 11 120789436 missense possibly damaging 0.92
R1763:Dus1l UTSW 11 120795671 missense probably benign 0.00
R4175:Dus1l UTSW 11 120795680 missense possibly damaging 0.94
R4753:Dus1l UTSW 11 120792075 missense probably benign 0.21
R4816:Dus1l UTSW 11 120789758 unclassified probably benign
R7056:Dus1l UTSW 11 120791294 missense probably benign 0.35
R7808:Dus1l UTSW 11 120789436 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCAGATAGTTATAGGCATTGG -3'
(R):5'- ACTCAGGGTTCTGCCTCTTG -3'

Sequencing Primer
(F):5'- TTGGGTAATGCTGAACAACCAC -3'
(R):5'- CCTGGGGCTCTTCCAAAG -3'
Posted On2015-02-05