Incidental Mutation 'R3149:Rock2'
ID264367
Institutional Source Beutler Lab
Gene Symbol Rock2
Ensembl Gene ENSMUSG00000020580
Gene NameRho-associated coiled-coil containing protein kinase 2
SynonymsB230113H15Rik, ROKalpha, Rho-kinase, Rock-II, Rock2m
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.845) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location16894895-16987823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16965091 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 762 (S762P)
Ref Sequence ENSEMBL: ENSMUSP00000152813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020904] [ENSMUST00000220688]
Predicted Effect probably damaging
Transcript: ENSMUST00000020904
AA Change: S762P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020904
Gene: ENSMUSG00000020580
AA Change: S762P

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
S_TKc 92 354 9.2e-96 SMART
S_TK_X 357 417 3.24e-13 SMART
PDB:3O0Z|D 552 717 4e-46 PDB
low complexity region 723 743 N/A INTRINSIC
low complexity region 882 909 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
Pfam:Rho_Binding 978 1046 4.7e-28 PFAM
coiled coil region 1054 1126 N/A INTRINSIC
PH 1151 1351 2.88e-5 SMART
C1 1261 1315 2.21e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220688
AA Change: S762P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. This protein, which is an isozyme of ROCK1 is a target for the small GTPase Rho. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this genes tend to die before birth; those that survive are small. Hemorrhaging occurs in the placenta, at the tips of hind limb buds and occasionally the tail. Subsequent development is normal and the size deficit is made up. They are fertile as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Rock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Rock2 APN 12 16978055 missense probably benign 0.11
IGL01565:Rock2 APN 12 16953317 missense possibly damaging 0.62
IGL01637:Rock2 APN 12 16965171 missense probably benign
IGL02164:Rock2 APN 12 16965529 missense probably damaging 1.00
IGL02249:Rock2 APN 12 16971041 unclassified probably benign
IGL02490:Rock2 APN 12 16948563 missense probably damaging 1.00
IGL02815:Rock2 APN 12 16966701 splice site probably benign
IGL02979:Rock2 APN 12 16977940 missense probably benign 0.00
IGL03095:Rock2 APN 12 16953340 missense probably benign 0.00
IGL03198:Rock2 APN 12 16975507 missense probably benign 0.27
R0087:Rock2 UTSW 12 16928966 missense probably benign 0.20
R0189:Rock2 UTSW 12 16959516 splice site probably benign
R0282:Rock2 UTSW 12 16977886 splice site probably benign
R0497:Rock2 UTSW 12 16954953 missense probably benign
R1210:Rock2 UTSW 12 16965469 missense probably damaging 0.96
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1347:Rock2 UTSW 12 16977624 missense possibly damaging 0.70
R1616:Rock2 UTSW 12 16972985 missense probably benign 0.03
R1672:Rock2 UTSW 12 16965652 missense probably benign 0.03
R1815:Rock2 UTSW 12 16972726 missense probably benign 0.01
R1840:Rock2 UTSW 12 16928989 missense probably benign
R2349:Rock2 UTSW 12 16977615 missense probably benign 0.07
R3979:Rock2 UTSW 12 16972736 missense probably damaging 1.00
R4030:Rock2 UTSW 12 16975479 missense probably damaging 1.00
R4470:Rock2 UTSW 12 16971275 nonsense probably null
R4492:Rock2 UTSW 12 16977683 missense probably damaging 1.00
R4519:Rock2 UTSW 12 16977737 missense probably damaging 1.00
R4776:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R4794:Rock2 UTSW 12 16940407 missense probably damaging 1.00
R4908:Rock2 UTSW 12 16959491 missense probably benign 0.00
R5363:Rock2 UTSW 12 16965654 critical splice donor site probably null
R5574:Rock2 UTSW 12 16961641 missense possibly damaging 0.55
R5595:Rock2 UTSW 12 16942809 missense probably damaging 1.00
R6158:Rock2 UTSW 12 16954918 missense probably benign
R6728:Rock2 UTSW 12 16961736 missense probably benign 0.00
R6828:Rock2 UTSW 12 16942959 splice site probably null
R7019:Rock2 UTSW 12 16977740 missense probably damaging 1.00
R7181:Rock2 UTSW 12 16973143 missense probably benign 0.00
R7236:Rock2 UTSW 12 16929002 missense probably damaging 1.00
R7362:Rock2 UTSW 12 16958421 missense probably damaging 1.00
R7593:Rock2 UTSW 12 16958240 missense probably benign 0.00
R7743:Rock2 UTSW 12 16976047 missense probably damaging 1.00
R7782:Rock2 UTSW 12 16971110 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTGCCTGGAATGTTTTATTGAAAG -3'
(R):5'- AACGCTTCTGAGTTTCCTGC -3'

Sequencing Primer
(F):5'- TGTCTTATAAAGACACAAAGAC -3'
(R):5'- TCATCAAATCCATTAAAAGCCAACAG -3'
Posted On2015-02-05