Mutagenetix > Incidental Mutations

Incidental Mutation 'R3149:Gpatch2l'

264368

Institutional Source

Beutler Lab

Gene Symbol

Gpatch2l

Ensembl Gene

ENSMUSG00000021254

Gene Name

G patch domain containing 2 like

Synonyms

1700020O03Rik

MMRRC Submission

040601-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3149 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86241858-86291784 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86244315 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 91 (T91A)

Ref Sequence

ENSEMBL: ENSMUSP00000152284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000221368]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071106
AA Change: T91A

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254
AA Change: T91A

Domain	Start	End	E-Value	Type
low complexity region	33	48	N/A	INTRINSIC
low complexity region	127	135	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	413	427	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221368
AA Change: T91A

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.0699

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	G	A	17: 56,876,348	A30T	probably benign	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Cel	T	C	2: 28,556,131	D576G	probably benign	Het
Csf2ra	C	A	19: 61,227,320	A16S	possibly damaging	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dus1l	T	C	11: 120,793,104	T173A	possibly damaging	Het
Dzip1	T	C	14: 118,911,368	T300A	probably benign	Het
Fam208b	G	A	13: 3,574,359	P1182S	probably damaging	Het
Ggta1	A	T	2: 35,402,623	I224N	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5150	A	G	3: 16,006,315	L3P	probably damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7137	T	C	10: 77,788,005		probably benign	Het
Hoxa13	G	T	6: 52,260,304		probably benign	Het
Ift46	A	G	9: 44,783,748	D65G	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Mapk11	T	C	15: 89,145,450		probably null	Het
Mettl25	T	C	10: 105,826,353	D252G	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Olfr479	C	T	7: 108,055,782	R267C	probably benign	Het
Pecam1	A	G	11: 106,684,281	V601A	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rassf9	A	T	10: 102,544,826	D21V	possibly damaging	Het
Rmnd5a	T	A	6: 71,429,101	I68L	probably benign	Het
Rock2	T	C	12: 16,965,091	S762P	probably damaging	Het
Srgap2	T	C	1: 131,292,589	T216A	probably benign	Het
Vmn1r86	T	A	7: 13,102,431	K123*	probably null	Het
Vmn2r68	A	C	7: 85,237,667	V13G	probably benign	Het
Vps13d	G	C	4: 145,126,577	N2322K	possibly damaging	Het
Xpo5	A	G	17: 46,242,247		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Gpatch2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02335:Gpatch2l	APN	12	86256937	splice site	probably benign
IGL02458:Gpatch2l	APN	12	86288961	utr 3 prime	probably benign
IGL03131:Gpatch2l	APN	12	86281511	missense	probably benign	0.00
R0546:Gpatch2l	UTSW	12	86288848	makesense	probably null
R1349:Gpatch2l	UTSW	12	86260709	missense	possibly damaging	0.94
R1368:Gpatch2l	UTSW	12	86260665	missense	possibly damaging	0.73
R1600:Gpatch2l	UTSW	12	86256934	critical splice donor site	probably null
R1701:Gpatch2l	UTSW	12	86288952	missense	probably benign	0.00
R2656:Gpatch2l	UTSW	12	86288810	missense	probably damaging	1.00
R3150:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3176:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3177:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3276:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R3277:Gpatch2l	UTSW	12	86244315	missense	possibly damaging	0.76
R4342:Gpatch2l	UTSW	12	86260679	missense	probably benign	0.00
R5161:Gpatch2l	UTSW	12	86267176	missense	probably benign	0.17
R5712:Gpatch2l	UTSW	12	86244480	missense	probably damaging	1.00
R6343:Gpatch2l	UTSW	12	86260605	nonsense	probably null
R6899:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6910:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6911:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6912:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6917:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6930:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6994:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6995:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6996:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6998:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R6999:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7000:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7001:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7002:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7003:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7010:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7011:Gpatch2l	UTSW	12	86244184	missense	probably damaging	1.00
R7203:Gpatch2l	UTSW	12	86288937	missense	probably benign	0.40
R7239:Gpatch2l	UTSW	12	86260575	critical splice acceptor site	probably null
R7327:Gpatch2l	UTSW	12	86256872	missense	probably damaging	1.00
R7419:Gpatch2l	UTSW	12	86265251	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCGGAGCAGAGCAAGCTTG -3'
(R):5'- TCTCATAGCTCCAATCTGACAC -3'

Sequencing Primer
(F):5'- TGAGCCCCAGACAGCAGAG -3'
(R):5'- CTGACACTTTCAGCTTCTGC -3'

Posted On

2015-02-05