Incidental Mutation 'R3149:Gpatch2l'
ID264368
Institutional Source Beutler Lab
Gene Symbol Gpatch2l
Ensembl Gene ENSMUSG00000021254
Gene NameG patch domain containing 2 like
Synonyms1700020O03Rik
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location86241858-86291784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86244315 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 91 (T91A)
Ref Sequence ENSEMBL: ENSMUSP00000152284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000221368]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071106
AA Change: T91A

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254
AA Change: T91A

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
low complexity region 127 135 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 413 427 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221368
AA Change: T91A

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Gpatch2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02335:Gpatch2l APN 12 86256937 splice site probably benign
IGL02458:Gpatch2l APN 12 86288961 utr 3 prime probably benign
IGL03131:Gpatch2l APN 12 86281511 missense probably benign 0.00
R0546:Gpatch2l UTSW 12 86288848 makesense probably null
R1349:Gpatch2l UTSW 12 86260709 missense possibly damaging 0.94
R1368:Gpatch2l UTSW 12 86260665 missense possibly damaging 0.73
R1600:Gpatch2l UTSW 12 86256934 critical splice donor site probably null
R1701:Gpatch2l UTSW 12 86288952 missense probably benign 0.00
R2656:Gpatch2l UTSW 12 86288810 missense probably damaging 1.00
R3150:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3176:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3177:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3276:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3277:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R4342:Gpatch2l UTSW 12 86260679 missense probably benign 0.00
R5161:Gpatch2l UTSW 12 86267176 missense probably benign 0.17
R5712:Gpatch2l UTSW 12 86244480 missense probably damaging 1.00
R6343:Gpatch2l UTSW 12 86260605 nonsense probably null
R6899:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6910:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6911:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6912:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6917:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6930:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6994:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6995:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6996:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6998:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6999:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7000:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7001:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7002:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7003:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7010:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7011:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7203:Gpatch2l UTSW 12 86288937 missense probably benign 0.40
R7239:Gpatch2l UTSW 12 86260575 critical splice acceptor site probably null
R7327:Gpatch2l UTSW 12 86256872 missense probably damaging 1.00
R7419:Gpatch2l UTSW 12 86265251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCGGAGCAGAGCAAGCTTG -3'
(R):5'- TCTCATAGCTCCAATCTGACAC -3'

Sequencing Primer
(F):5'- TGAGCCCCAGACAGCAGAG -3'
(R):5'- CTGACACTTTCAGCTTCTGC -3'
Posted On2015-02-05