Incidental Mutation 'R3149:Xpo5'
ID264372
Institutional Source Beutler Lab
Gene Symbol Xpo5
Ensembl Gene ENSMUSG00000067150
Gene Nameexportin 5
SynonymsExp5, 2700038C24Rik, 2410004H11Rik
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46202855-46242299 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 46242247 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000087031] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably null
Transcript: ENSMUST00000087031
SMART Domains Protein: ENSMUSP00000084257
Gene: ENSMUSG00000067150

DomainStartEndE-ValueType
IBN_N 33 100 6.73e-3 SMART
Pfam:Xpo1 109 271 1.4e-34 PFAM
low complexity region 326 342 N/A INTRINSIC
low complexity region 770 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Xpo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Xpo5 APN 17 46225047 missense probably damaging 1.00
IGL00650:Xpo5 APN 17 46208246 missense probably damaging 1.00
IGL00785:Xpo5 APN 17 46204692 missense probably damaging 1.00
IGL01869:Xpo5 APN 17 46242207 missense possibly damaging 0.75
IGL01929:Xpo5 APN 17 46202929 missense probably benign 0.13
IGL02433:Xpo5 APN 17 46239520 missense probably damaging 0.99
IGL02550:Xpo5 APN 17 46229329 missense probably benign 0.16
IGL02637:Xpo5 APN 17 46235979 missense probably damaging 1.00
IGL02942:Xpo5 APN 17 46208133 missense probably damaging 0.99
IGL03004:Xpo5 APN 17 46207840 missense probably damaging 1.00
IGL03149:Xpo5 APN 17 46215814 splice site probably null
IGL03296:Xpo5 APN 17 46221394 nonsense probably null
fortify UTSW 17 46221421 missense probably benign 0.01
fortissimo UTSW 17 46235970 missense probably benign 0.36
PIT4403001:Xpo5 UTSW 17 46239569 missense probably benign 0.01
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0035:Xpo5 UTSW 17 46240175 missense probably benign
R0276:Xpo5 UTSW 17 46241507 missense probably damaging 1.00
R0626:Xpo5 UTSW 17 46221433 missense probably damaging 1.00
R0843:Xpo5 UTSW 17 46222650 splice site probably benign
R1440:Xpo5 UTSW 17 46207927 splice site probably benign
R1506:Xpo5 UTSW 17 46227888 missense probably benign 0.04
R1513:Xpo5 UTSW 17 46226980 missense probably benign 0.06
R2060:Xpo5 UTSW 17 46225091 missense probably damaging 1.00
R2258:Xpo5 UTSW 17 46240896 nonsense probably null
R2259:Xpo5 UTSW 17 46240896 nonsense probably null
R2260:Xpo5 UTSW 17 46240896 nonsense probably null
R2263:Xpo5 UTSW 17 46230343 missense probably benign
R3016:Xpo5 UTSW 17 46220831 missense probably damaging 1.00
R3150:Xpo5 UTSW 17 46242247 splice site probably null
R4613:Xpo5 UTSW 17 46236963 missense probably benign
R4784:Xpo5 UTSW 17 46222717 missense possibly damaging 0.59
R4808:Xpo5 UTSW 17 46235970 missense probably benign 0.36
R4981:Xpo5 UTSW 17 46220817 missense probably damaging 0.99
R5159:Xpo5 UTSW 17 46217609 missense probably damaging 1.00
R5286:Xpo5 UTSW 17 46234480 missense probably benign
R5294:Xpo5 UTSW 17 46236922 missense probably benign 0.12
R5550:Xpo5 UTSW 17 46234492 missense possibly damaging 0.87
R5750:Xpo5 UTSW 17 46218630 critical splice donor site probably null
R5774:Xpo5 UTSW 17 46241846 nonsense probably null
R5921:Xpo5 UTSW 17 46221421 missense probably benign 0.01
R6165:Xpo5 UTSW 17 46235957 missense possibly damaging 0.53
R6576:Xpo5 UTSW 17 46240808 splice site probably null
R7244:Xpo5 UTSW 17 46214625 missense probably damaging 1.00
R7414:Xpo5 UTSW 17 46221369 missense probably benign
R7737:Xpo5 UTSW 17 46236090 splice site probably null
R8144:Xpo5 UTSW 17 46208219 missense probably benign 0.09
X0019:Xpo5 UTSW 17 46234544 missense probably benign 0.00
X0062:Xpo5 UTSW 17 46230266 missense probably damaging 1.00
Z1176:Xpo5 UTSW 17 46220762 missense probably benign 0.11
Z1177:Xpo5 UTSW 17 46225124 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCAGGATGTCTCTAACTCACAG -3'
(R):5'- AATGGCGTAGGTCCCAACAC -3'

Sequencing Primer
(F):5'- GGATGTCTCTAACTCACAGCCTGG -3'
(R):5'- ACCCTGCACTCTAGTAGGATG -3'
Posted On2015-02-05