Incidental Mutation 'R3149:Csf2ra'
ID264374
Institutional Source Beutler Lab
Gene Symbol Csf2ra
Ensembl Gene ENSMUSG00000059326
Gene Namecolony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
SynonymsCsfgmra, CD116, GM-CSFRalpha, GM-CSF-Ra
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3149 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location61224402-61228418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61227320 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 16 (A16S)
Ref Sequence ENSEMBL: ENSMUSP00000075423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076046
AA Change: A16S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075423
Gene: ENSMUSG00000059326
AA Change: A16S

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:IL6Ra-bind 129 223 5.2e-23 PFAM
FN3 226 311 9.19e-1 SMART
transmembrane domain 326 348 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Csf2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Csf2ra APN 19 61226833 missense possibly damaging 0.87
IGL01465:Csf2ra APN 19 61225998 missense possibly damaging 0.95
IGL01693:Csf2ra APN 19 61225996 missense possibly damaging 0.57
IGL02474:Csf2ra APN 19 61226537 missense possibly damaging 0.95
IGL02950:Csf2ra APN 19 61227169 missense probably benign 0.01
R0054:Csf2ra UTSW 19 61226597 missense probably damaging 1.00
R0201:Csf2ra UTSW 19 61225568 missense probably benign 0.14
R0452:Csf2ra UTSW 19 61226895 missense probably benign 0.02
R1735:Csf2ra UTSW 19 61226344 missense probably damaging 0.99
R2016:Csf2ra UTSW 19 61226893 missense probably benign 0.01
R2157:Csf2ra UTSW 19 61227071 missense probably benign 0.05
R3150:Csf2ra UTSW 19 61227320 missense possibly damaging 0.83
R4747:Csf2ra UTSW 19 61226053 nonsense probably null
R4825:Csf2ra UTSW 19 61226552 missense probably benign 0.10
R5580:Csf2ra UTSW 19 61226217 missense probably damaging 1.00
R5831:Csf2ra UTSW 19 61225212 missense probably damaging 1.00
R5887:Csf2ra UTSW 19 61227328 missense possibly damaging 0.92
R7105:Csf2ra UTSW 19 61225020 missense possibly damaging 0.61
R7123:Csf2ra UTSW 19 61226862 missense probably damaging 1.00
R7419:Csf2ra UTSW 19 61227053 missense possibly damaging 0.94
R7721:Csf2ra UTSW 19 61226586 missense probably damaging 1.00
Z1177:Csf2ra UTSW 19 61225153 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACGACCGGAAGTGACATC -3'
(R):5'- GGGAATCAATAGGATAACGTCACC -3'

Sequencing Primer
(F):5'- CGACCGGAAGTGACATCATTGC -3'
(R):5'- GCATGGCTCAGATGGCAG -3'
Posted On2015-02-05