Incidental Mutation 'R3149:Prkx'
ID264375
Institutional Source Beutler Lab
Gene Symbol Prkx
Ensembl Gene ENSMUSG00000035725
Gene Nameprotein kinase, X-linked
SynonymsPkare
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R3149 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location77761411-77796278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77771275 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 260 (F260I)
Ref Sequence ENSEMBL: ENSMUSP00000045304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036333] [ENSMUST00000114044]
Predicted Effect probably damaging
Transcript: ENSMUST00000036333
AA Change: F260I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045304
Gene: ENSMUSG00000035725
AA Change: F260I

DomainStartEndE-ValueType
S_TKc 46 300 5.53e-99 SMART
S_TK_X 301 355 8.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114044
SMART Domains Protein: ENSMUSP00000109678
Gene: ENSMUSG00000035725

DomainStartEndE-ValueType
Pfam:Pkinase 46 237 1.1e-59 PFAM
Pfam:Pkinase_Tyr 47 237 2.6e-33 PFAM
Pfam:Kinase-like 131 237 1.3e-7 PFAM
Meta Mutation Damage Score 0.7454 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine threonine protein kinase that has similarity to the catalytic subunit of cyclic AMP dependent protein kinases. The encoded protein is developmentally regulated and may be involved in renal epithelial morphogenesis. This protein may also be involved in macrophage and granulocyte maturation. Abnormal recombination between this gene and a related pseudogene on chromosome Y is a frequent cause of sex reversal disorder in XX males and XY females. Pseudogenes of this gene are found on chromosomes X, 15 and Y. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hoxa13 G T 6: 52,260,304 probably benign Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Prkx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03218:Prkx APN X 77786200 missense probably damaging 1.00
R2019:Prkx UTSW X 77765404 missense probably damaging 1.00
R2157:Prkx UTSW X 77771314 missense probably benign 0.12
R3176:Prkx UTSW X 77771275 missense probably damaging 0.99
R3276:Prkx UTSW X 77771275 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGTTAATTTCAACACTGTCCATC -3'
(R):5'- CAAGCAGTGGATCCATTTGAC -3'

Sequencing Primer
(F):5'- AACTGAAACGTTTTTCTTTCCTGGTG -3'
(R):5'- CTCTACTAAATATCCATGCTTCT -3'
Posted On2015-02-05