Incidental Mutation 'R3151:Ptges2'
ID264381
Institutional Source Beutler Lab
Gene Symbol Ptges2
Ensembl Gene ENSMUSG00000026820
Gene Nameprostaglandin E synthase 2
SynonymsGBF1, GBF-1, 0610038H10Rik
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3151 (G1)
Quality Score104
Status Validated
Chromosome2
Chromosomal Location32395896-32405772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32396476 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 68 (A68T)
Ref Sequence ENSEMBL: ENSMUSP00000028162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028162] [ENSMUST00000123714]
Predicted Effect probably benign
Transcript: ENSMUST00000028162
AA Change: A68T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000028162
Gene: ENSMUSG00000026820
AA Change: A68T

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
low complexity region 57 71 N/A INTRINSIC
Pfam:Glutaredoxin 101 156 4.6e-10 PFAM
Pfam:GST_N_3 103 174 4.5e-14 PFAM
Pfam:GST_N_2 108 174 2.5e-9 PFAM
Pfam:GST_C_3 223 367 6.2e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123714
AA Change: A13T
SMART Domains Protein: ENSMUSP00000141638
Gene: ENSMUSG00000026820
AA Change: A13T

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130121
Meta Mutation Damage Score 0.0760 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: The protein encoded by this gene is a Golgi membrane-associated prostaglandin E synthase candidate, which is capable of catalyzing the conversion of prostaglandin H2 to prostaglandin E2 in vitro. However, a study using mice deficient of this gene suggests that this enzyme does not contribute to prostaglandin E2 biosynthesis in vivo. This protein is synthesized as a Golgi membrane-bound protein, but its N-terminal hydrophobic region is cleaved off during protein maturation to produce the predominant soluble truncated form that still retains the enzyme activity. This soluble protein also has been shown to activate the transcription regulated by a gamma-interferon-activated transcription element (GATE), possibly via an interaction with CAAAT/enhancer-binding protein-beta. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal basal prostaglandin E2 (PGE2) protein levels in the lactating mammary gland. Mice homozygous for a different knock-out allele exhibit increased sensitivity to IgE antigen-dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Ptges2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01998:Ptges2 APN 2 32401530 missense possibly damaging 0.89
IGL02484:Ptges2 APN 2 32397707 missense probably damaging 1.00
R1463:Ptges2 UTSW 2 32400862 intron probably null
R1993:Ptges2 UTSW 2 32400092 missense probably benign 0.25
R4795:Ptges2 UTSW 2 32396322 nonsense probably null
R6974:Ptges2 UTSW 2 32397671 missense possibly damaging 0.55
R7007:Ptges2 UTSW 2 32402306 missense probably benign
R7881:Ptges2 UTSW 2 32402231 missense probably damaging 1.00
R7964:Ptges2 UTSW 2 32402231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGGAATCCTAGAGCCGCC -3'
(R):5'- TTAAGGCCAAGACACTCGCC -3'

Sequencing Primer
(F):5'- CAGAGCGAACATGGCCCAG -3'
(R):5'- GACACTCGCCCAAGGTC -3'
Posted On2015-02-05