Incidental Mutation 'R3151:Dync1i2'
ID264382
Institutional Source Beutler Lab
Gene Symbol Dync1i2
Ensembl Gene ENSMUSG00000027012
Gene Namedynein cytoplasmic 1 intermediate chain 2
Synonyms3110079H08Rik, Dncic2
MMRRC Submission 040603-MU
Accession Numbers

Genbank: NM_010064; MGI: 107750

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location71211706-71263303 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 71233716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081710] [ENSMUST00000100028] [ENSMUST00000112136] [ENSMUST00000112138] [ENSMUST00000112139] [ENSMUST00000112140] [ENSMUST00000112142] [ENSMUST00000112144]
Predicted Effect probably benign
Transcript: ENSMUST00000081710
SMART Domains Protein: ENSMUSP00000080410
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100028
SMART Domains Protein: ENSMUSP00000097605
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112136
SMART Domains Protein: ENSMUSP00000107764
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 5e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 618 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112138
SMART Domains Protein: ENSMUSP00000107766
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 1.1e-20 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 593 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112139
SMART Domains Protein: ENSMUSP00000107767
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 106 138 4.5e-21 PFAM
low complexity region 155 169 N/A INTRINSIC
Blast:WD40 243 291 3e-26 BLAST
WD40 296 335 5.55e-1 SMART
WD40 342 385 7.16e-1 SMART
WD40 439 484 7.39e-3 SMART
WD40 487 527 7.28e-2 SMART
WD40 532 572 8.91e-1 SMART
low complexity region 592 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112140
SMART Domains Protein: ENSMUSP00000107768
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 132 164 2.6e-21 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112142
SMART Domains Protein: ENSMUSP00000107770
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 73 91 N/A INTRINSIC
Pfam:Dynein_IC2 126 158 2.8e-21 PFAM
low complexity region 175 189 N/A INTRINSIC
Blast:WD40 263 311 4e-26 BLAST
WD40 316 355 5.55e-1 SMART
WD40 362 405 7.16e-1 SMART
WD40 459 504 7.39e-3 SMART
WD40 507 547 7.28e-2 SMART
WD40 552 592 8.91e-1 SMART
low complexity region 613 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112144
SMART Domains Protein: ENSMUSP00000107772
Gene: ENSMUSG00000027012

DomainStartEndE-ValueType
coiled coil region 1 67 N/A INTRINSIC
low complexity region 83 97 N/A INTRINSIC
Pfam:Dynein_IC2 133 163 6.5e-19 PFAM
low complexity region 181 195 N/A INTRINSIC
Blast:WD40 269 317 4e-26 BLAST
WD40 322 361 5.55e-1 SMART
WD40 368 411 7.16e-1 SMART
WD40 465 510 7.39e-3 SMART
WD40 513 553 7.28e-2 SMART
WD40 558 598 8.91e-1 SMART
low complexity region 619 633 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149735
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit a trend towards slight locomotor deficit. [provided by MGI curators]
Allele List at MGI

All alleles(50) : Targeted, other(2) Gene trapped(48)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Dync1i2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Dync1i2 APN 2 71247955 splice site probably benign
IGL01609:Dync1i2 APN 2 71247008 splice site probably benign
IGL02479:Dync1i2 APN 2 71235979 missense probably damaging 1.00
IGL02545:Dync1i2 APN 2 71262751 missense possibly damaging 0.95
3-1:Dync1i2 UTSW 2 71247828 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0015:Dync1i2 UTSW 2 71214484 missense probably damaging 1.00
R0437:Dync1i2 UTSW 2 71227825 critical splice acceptor site probably null
R0555:Dync1i2 UTSW 2 71214518 frame shift probably null
R0835:Dync1i2 UTSW 2 71250972 missense probably damaging 1.00
R1146:Dync1i2 UTSW 2 71227820 splice site probably benign
R1452:Dync1i2 UTSW 2 71249863 splice site probably benign
R1662:Dync1i2 UTSW 2 71250979 missense possibly damaging 0.87
R1765:Dync1i2 UTSW 2 71249415 missense probably benign
R2059:Dync1i2 UTSW 2 71249853 critical splice donor site probably null
R2145:Dync1i2 UTSW 2 71214563 splice site probably benign
R2233:Dync1i2 UTSW 2 71249420 nonsense probably null
R2234:Dync1i2 UTSW 2 71249420 nonsense probably null
R2235:Dync1i2 UTSW 2 71249420 nonsense probably null
R3916:Dync1i2 UTSW 2 71249372 missense probably damaging 1.00
R4653:Dync1i2 UTSW 2 71247855 missense probably damaging 1.00
R4720:Dync1i2 UTSW 2 71233674 missense probably damaging 1.00
R4920:Dync1i2 UTSW 2 71247324 missense probably damaging 1.00
R5574:Dync1i2 UTSW 2 71233650 missense probably benign 0.15
R5620:Dync1i2 UTSW 2 71258139 missense probably benign 0.00
R5677:Dync1i2 UTSW 2 71228623 missense probably benign 0.00
R5711:Dync1i2 UTSW 2 71250982 missense probably benign 0.31
R6730:Dync1i2 UTSW 2 71247140 missense probably benign 0.18
R6911:Dync1i2 UTSW 2 71247102 missense probably benign
R7140:Dync1i2 UTSW 2 71247939 missense probably benign 0.03
R7257:Dync1i2 UTSW 2 71249356 missense possibly damaging 0.92
R7460:Dync1i2 UTSW 2 71250886 missense probably damaging 0.97
R7808:Dync1i2 UTSW 2 71250834 splice site probably null
R8187:Dync1i2 UTSW 2 71214521 missense probably benign 0.13
Z1176:Dync1i2 UTSW 2 71247884 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCATTGGAGTTAGACCTAGTATG -3'
(R):5'- AAGTAGGGAAACTTATGGTACCTAG -3'

Sequencing Primer
(F):5'- CTAACCGTGTAGTTAGTTCTTAGTTG -3'
(R):5'- CTTAACTAGACACAATGTTAGAAAC -3'
Posted On2015-02-05