Incidental Mutation 'R3151:Ano2'
ID264398
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Nameanoctamin 2
SynonymsTmem16b
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location125690419-126040126 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 126013317 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159984] [ENSMUST00000160496]
Predicted Effect probably benign
Transcript: ENSMUST00000159984
SMART Domains Protein: ENSMUSP00000123965
Gene: ENSMUSG00000038115

DomainStartEndE-ValueType
Pfam:Anoctamin 21 181 1.7e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160496
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161619
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 126013253 missense probably damaging 1.00
IGL01387:Ano2 APN 6 126013277 missense probably damaging 0.99
IGL01772:Ano2 APN 6 126036858 missense probably damaging 0.98
IGL01931:Ano2 APN 6 125982745 missense probably damaging 1.00
IGL02066:Ano2 APN 6 125690739 missense probably benign 0.07
IGL02410:Ano2 APN 6 125815533 critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125872751 critical splice donor site probably null
IGL03116:Ano2 APN 6 125980171 nonsense probably null
IGL03183:Ano2 APN 6 125710629 missense probably benign
IGL03391:Ano2 APN 6 125807839 missense probably damaging 1.00
R0257:Ano2 UTSW 6 125880713 missense probably benign 0.05
R0462:Ano2 UTSW 6 125712275 missense probably benign 0.26
R0594:Ano2 UTSW 6 125982765 missense probably damaging 1.00
R1072:Ano2 UTSW 6 126039324 missense probably damaging 1.00
R1099:Ano2 UTSW 6 125807847 missense probably damaging 1.00
R1436:Ano2 UTSW 6 125867171 critical splice donor site probably null
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1822:Ano2 UTSW 6 125863457 missense probably damaging 1.00
R1901:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1902:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1911:Ano2 UTSW 6 126013691 missense probably benign 0.00
R2040:Ano2 UTSW 6 126039508 missense probably benign 0.13
R2192:Ano2 UTSW 6 126015539 missense probably damaging 1.00
R2307:Ano2 UTSW 6 125992886 missense probably benign 0.00
R2698:Ano2 UTSW 6 125712346 missense probably benign 0.01
R2878:Ano2 UTSW 6 125863518 missense probably damaging 1.00
R4004:Ano2 UTSW 6 126013279 missense probably damaging 1.00
R4664:Ano2 UTSW 6 125863538 missense probably benign 0.07
R4684:Ano2 UTSW 6 125790341 missense probably benign 0.00
R4685:Ano2 UTSW 6 125980124 nonsense probably null
R4686:Ano2 UTSW 6 125790291 missense probably benign 0.10
R4852:Ano2 UTSW 6 125982923 missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125903055 utr 3 prime probably benign
R5488:Ano2 UTSW 6 126039253 missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126039322 missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125872740 missense probably damaging 1.00
R5876:Ano2 UTSW 6 126039279 missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125992955 missense probably benign 0.15
R6219:Ano2 UTSW 6 125815590 missense probably damaging 1.00
R6613:Ano2 UTSW 6 125806656 splice site probably null
R6711:Ano2 UTSW 6 125775832 missense probably damaging 1.00
R6982:Ano2 UTSW 6 125992893 missense probably benign
R7153:Ano2 UTSW 6 125992943 missense possibly damaging 0.73
R7182:Ano2 UTSW 6 125790293 missense probably damaging 0.99
R7312:Ano2 UTSW 6 126039497 nonsense probably null
R7358:Ano2 UTSW 6 125710733 missense probably benign
R7456:Ano2 UTSW 6 125963545 missense probably benign 0.01
R7532:Ano2 UTSW 6 125963704 missense probably damaging 1.00
R7607:Ano2 UTSW 6 125712419 missense probably damaging 1.00
R7623:Ano2 UTSW 6 126015573 nonsense probably null
R7690:Ano2 UTSW 6 126013198 missense probably damaging 1.00
Z1176:Ano2 UTSW 6 125710707 missense probably benign
Z1176:Ano2 UTSW 6 125863453 nonsense probably null
Z1177:Ano2 UTSW 6 126013207 missense probably damaging 1.00
Z1177:Ano2 UTSW 6 126015647 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGGATGGGCTTTGCTCC -3'
(R):5'- GGGGTAGTTAAATGACTTCCACTG -3'

Sequencing Primer
(F):5'- GCTGAAGCCTCTCCTGTGTG -3'
(R):5'- TGGCCTTCCCACATCCAAGG -3'
Posted On2015-02-05