Incidental Mutation 'R3151:Gys2'
ID264399
Institutional Source Beutler Lab
Gene Symbol Gys2
Ensembl Gene ENSMUSG00000030244
Gene Nameglycogen synthase 2
Synonymsglycogen synthase, liver, LGS
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142422613-142473109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142456333 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 260 (E260G)
Ref Sequence ENSEMBL: ENSMUSP00000032371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032371]
Predicted Effect probably benign
Transcript: ENSMUST00000032371
AA Change: E260G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244
AA Change: E260G

DomainStartEndE-ValueType
Pfam:Glycogen_syn 32 667 N/A PFAM
Meta Mutation Damage Score 0.1867 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Gys2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Gys2 APN 6 142463290 nonsense probably null
IGL02963:Gys2 APN 6 142449428 critical splice donor site probably null
IGL02997:Gys2 APN 6 142449469 missense probably damaging 1.00
candy_corn UTSW 6 142456333 missense probably benign 0.00
embittered UTSW 6 142454484 missense possibly damaging 0.92
hazelnut UTSW 6 142449455 missense possibly damaging 0.67
R0243:Gys2 UTSW 6 142472668 splice site probably benign
R1124:Gys2 UTSW 6 142446013 missense probably damaging 0.97
R1188:Gys2 UTSW 6 142455183 missense probably damaging 1.00
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1208:Gys2 UTSW 6 142450467 critical splice donor site probably null
R1235:Gys2 UTSW 6 142430293 missense probably damaging 1.00
R1387:Gys2 UTSW 6 142461283 missense probably benign 0.06
R1758:Gys2 UTSW 6 142472706 missense probably damaging 1.00
R1819:Gys2 UTSW 6 142461186 missense probably damaging 1.00
R2221:Gys2 UTSW 6 142456422 missense probably damaging 1.00
R2311:Gys2 UTSW 6 142463244 missense possibly damaging 0.81
R2344:Gys2 UTSW 6 142446022 missense probably damaging 0.99
R3902:Gys2 UTSW 6 142472800 start codon destroyed probably null 0.98
R4532:Gys2 UTSW 6 142455141 missense probably damaging 0.98
R4577:Gys2 UTSW 6 142454510 missense possibly damaging 0.93
R4588:Gys2 UTSW 6 142449455 missense possibly damaging 0.67
R4606:Gys2 UTSW 6 142454484 missense possibly damaging 0.92
R5338:Gys2 UTSW 6 142454513 missense probably damaging 1.00
R5411:Gys2 UTSW 6 142448421 missense probably damaging 0.99
R6072:Gys2 UTSW 6 142428537 missense probably damaging 0.98
R6261:Gys2 UTSW 6 142459408 missense probably benign
R6366:Gys2 UTSW 6 142463394 missense probably benign 0.02
R6597:Gys2 UTSW 6 142456309 missense probably benign 0.25
R6930:Gys2 UTSW 6 142459380 critical splice donor site probably null
R7033:Gys2 UTSW 6 142472722 missense probably benign 0.08
R7663:Gys2 UTSW 6 142459485 missense probably damaging 1.00
R7757:Gys2 UTSW 6 142454451 missense probably benign 0.10
R7848:Gys2 UTSW 6 142446015 nonsense probably null
R7852:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R7931:Gys2 UTSW 6 142446015 nonsense probably null
R7935:Gys2 UTSW 6 142430333 missense probably damaging 1.00
R8008:Gys2 UTSW 6 142454517 missense probably damaging 1.00
R8037:Gys2 UTSW 6 142448393 missense probably benign 0.44
R8070:Gys2 UTSW 6 142448504 critical splice acceptor site probably null
R8152:Gys2 UTSW 6 142427410 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGAAGACCCCACCTCTAG -3'
(R):5'- CAGACTTGAAGTGAACAGTGCTG -3'

Sequencing Primer
(F):5'- TGAAGACCCCACCTCTAGACACC -3'
(R):5'- GGGGTCTTTACAACTTCAATCAGC -3'
Posted On2015-02-05