Mutagenetix > Incidental Mutation

Incidental Mutation 'R0344:Nup133'

26440

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

038551-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0344 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123917446 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 727 (V727A)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

AlphaFold

Q8R0G9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044795
AA Change: V727A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: V727A

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213089

Meta Mutation Damage Score

0.5008

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.3%
20x: 93.6%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553J12Rik	T	A	16: 88,820,301	C29*	probably null	Het
Abca4	G	A	3: 122,083,964	C324Y	probably damaging	Het
Ablim2	T	G	5: 35,836,933		probably benign	Het
Abr	A	T	11: 76,479,044	V115E	probably damaging	Het
Adgrl2	C	T	3: 148,865,595		probably null	Het
Aff3	A	T	1: 38,203,932	S936T	probably benign	Het
Agap3	T	C	5: 24,451,202		probably benign	Het
Ahrr	T	A	13: 74,214,586	S393C	probably damaging	Het
Amfr	T	C	8: 93,987,370		probably null	Het
Ankrd26	C	A	6: 118,507,637		probably null	Het
Asxl3	G	A	18: 22,517,611	V886I	probably benign	Het
Atp5a1	C	A	18: 77,780,195	N356K	probably damaging	Het
Atp5s	T	C	12: 69,740,889		probably benign	Het
AU021092	A	T	16: 5,222,167	M31K	possibly damaging	Het
Bicral	A	G	17: 46,814,052		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C3ar1	T	C	6: 122,850,772	D162G	probably benign	Het
Camkk2	C	T	5: 122,763,877	C123Y	probably benign	Het
Casp8ap2	A	T	4: 32,644,079	I1051F	probably damaging	Het
Catsperg1	A	T	7: 29,195,540	V544E	probably damaging	Het
Cdc27	G	A	11: 104,526,991		probably benign	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Dennd6b	T	C	15: 89,196,229	Q56R	probably benign	Het
Fbxl17	G	A	17: 63,385,067		probably benign	Het
Fubp1	T	C	3: 152,219,713	V164A	probably damaging	Het
Gdap2	G	A	3: 100,178,256	G165S	probably damaging	Het
Gm13084	A	T	4: 143,810,768	I331N	probably damaging	Het
Gns	A	G	10: 121,383,423	K352E	probably benign	Het
Gtf2ird2	C	T	5: 134,191,249	T22M	probably damaging	Het
Herc3	A	G	6: 58,868,628		probably benign	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Inpp1	A	T	1: 52,799,354	F45L	probably damaging	Het
Ipo4	T	C	14: 55,625,942	Q1073R	possibly damaging	Het
Itgae	A	G	11: 73,118,147	K485E	probably benign	Het
Jak2	G	A	19: 29,283,629	V342I	probably damaging	Het
Kptn	C	A	7: 16,125,741	Q297K	probably damaging	Het
Lims2	A	G	18: 31,944,520	E103G	probably benign	Het
Mthfr	C	G	4: 148,055,428	S618W	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Oas2	T	G	5: 120,743,087	E313A	probably damaging	Het
Olfr1031	T	A	2: 85,992,382	C188*	probably null	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr487	A	T	7: 108,211,742	Y262*	probably null	Het
Olfr691	C	A	7: 105,337,607	M36I	probably benign	Het
Olfr961	G	A	9: 39,647,350	C208Y	probably damaging	Het
Park7	A	G	4: 150,908,349	V20A	possibly damaging	Het
Phldb1	C	A	9: 44,701,667	V919L	probably benign	Het
Pkhd1l1	C	A	15: 44,597,011	H4205Q	probably benign	Het
Plekhg3	G	T	12: 76,566,266	E449*	probably null	Het
Pstpip1	T	C	9: 56,126,645	V301A	probably benign	Het
Ptdss1	G	A	13: 66,933,572	R22H	probably damaging	Het
Ptprq	A	G	10: 107,705,582	V361A	probably benign	Het
Ralgapa2	A	T	2: 146,346,794	V1309E	possibly damaging	Het
Rere	T	C	4: 150,610,981		probably benign	Het
Sbk3	T	A	7: 4,967,405	T322S	possibly damaging	Het
Scn9a	T	A	2: 66,505,010	I1203L	probably damaging	Het
Setdb1	A	T	3: 95,326,131		probably benign	Het
Sik3	C	A	9: 46,208,811	Q683K	probably damaging	Het
Slc24a5	A	G	2: 125,085,701	I307V	probably benign	Het
Smg6	A	G	11: 74,929,821	D306G	probably damaging	Het
Snx13	G	A	12: 35,086,900	W120*	probably null	Het
Snx5	A	G	2: 144,257,208		probably benign	Het
Srsf5	T	C	12: 80,947,524	S76P	probably benign	Het
Stard6	A	G	18: 70,496,115	D31G	probably damaging	Het
Taf3	A	G	2: 9,951,898	M333T	probably benign	Het
Taf6	T	G	5: 138,181,147	I377L	probably benign	Het
Taf8	G	T	17: 47,493,580	N252K	probably benign	Het
Tfap2c	A	G	2: 172,551,503	T113A	probably benign	Het
Tmem246	T	C	4: 49,586,566	T201A	probably benign	Het
Tmtc4	C	T	14: 122,978,160	V25M	probably damaging	Het
Topbp1	T	A	9: 103,328,687	D841E	probably damaging	Het
Topbp1	T	A	9: 103,308,733		probably benign	Het
Ttn	A	T	2: 76,712,489	D33384E	probably damaging	Het
Unc13c	T	C	9: 73,930,785	E928G	probably benign	Het
Vav1	T	C	17: 57,296,090	F81L	probably damaging	Het
Vmn2r63	A	G	7: 42,903,618	I738T	probably damaging	Het
Vmn2r87	C	T	10: 130,479,937	E87K	probably damaging	Het
Zfp229	A	T	17: 21,745,841	M351L	probably benign	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Cadenza	UTSW	8	123911888	frame shift	probably null
Gangen	UTSW	8	123916282	critical splice donor site	probably null
hochzeit	UTSW	8	123929343	missense	probably benign	0.00
low_road	UTSW	8	123904579	missense	probably damaging	1.00
Pathway	UTSW	8	123917446	missense	possibly damaging	0.82
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6763:Nup133	UTSW	8	123944278	missense	possibly damaging	0.95
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217	intron	probably benign
R8397:Nup133	UTSW	8	123922417	missense	probably benign	0.17
R8703:Nup133	UTSW	8	123916282	critical splice donor site	probably null
R8811:Nup133	UTSW	8	123911888	frame shift	probably null
R8813:Nup133	UTSW	8	123911888	frame shift	probably null
R8952:Nup133	UTSW	8	123907761	missense	probably damaging	1.00
R9116:Nup133	UTSW	8	123933416	missense	probably benign	0.00
R9340:Nup133	UTSW	8	123938142	missense	probably benign	0.38
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCAGAGAAAGGAACGGACTCCATT -3'
(R):5'- GGAGCCTTCATTGGCTTTTGTTAGACAT -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- tcccccaccccaaatacc -3'

Posted On

2013-04-16