Incidental Mutation 'R3151:Olfr527'
ID264406
Institutional Source Beutler Lab
Gene Symbol Olfr527
Ensembl Gene ENSMUSG00000062782
Gene Nameolfactory receptor 527
SynonymsGA_x6K02T2PBJ9-42486061-42486978, MOR251-5
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140334017-140338551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140336330 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 156 (H156L)
Ref Sequence ENSEMBL: ENSMUSP00000149080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172230] [ENSMUST00000214143] [ENSMUST00000214858]
Predicted Effect probably benign
Transcript: ENSMUST00000172230
AA Change: H156L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129414
Gene: ENSMUSG00000062782
AA Change: H156L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 179 9.1e-8 PFAM
Pfam:7tm_1 39 287 7.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214143
AA Change: H156L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214858
AA Change: H156L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.3283 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Olfr527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:Olfr527 APN 7 140336606 missense possibly damaging 0.90
IGL02885:Olfr527 APN 7 140336159 missense possibly damaging 0.94
R1340:Olfr527 UTSW 7 140336125 missense probably benign 0.10
R1711:Olfr527 UTSW 7 140335999 missense possibly damaging 0.55
R1860:Olfr527 UTSW 7 140336219 missense possibly damaging 0.78
R2042:Olfr527 UTSW 7 140335937 missense probably damaging 1.00
R2072:Olfr527 UTSW 7 140336653 missense possibly damaging 0.85
R2128:Olfr527 UTSW 7 140336429 missense probably damaging 1.00
R2347:Olfr527 UTSW 7 140336147 missense probably damaging 0.98
R2449:Olfr527 UTSW 7 140336432 missense probably benign
R2973:Olfr527 UTSW 7 140336387 missense probably damaging 1.00
R4320:Olfr527 UTSW 7 140336306 missense possibly damaging 0.94
R5561:Olfr527 UTSW 7 140336152 nonsense probably null
R5566:Olfr527 UTSW 7 140336067 missense probably damaging 1.00
R5891:Olfr527 UTSW 7 140336600 missense probably benign 0.06
R7227:Olfr527 UTSW 7 140335621 start gained probably benign
R7296:Olfr527 UTSW 7 140336741 missense possibly damaging 0.91
R7568:Olfr527 UTSW 7 140335982 missense probably damaging 1.00
R8000:Olfr527 UTSW 7 140336342 missense possibly damaging 0.61
R8171:Olfr527 UTSW 7 140336230 missense probably damaging 1.00
R8203:Olfr527 UTSW 7 140336026 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TACTGGACAGCATGATGACAGG -3'
(R):5'- GGATTGTCACAGAGAAGTTCCC -3'

Sequencing Primer
(F):5'- TGATGACAGGAAGGACCATCTCTTAC -3'
(R):5'- GATTGTCACAGAGAAGTTCCCTACAG -3'
Posted On2015-02-05