Incidental Mutation 'R3151:Th'
ID264407
Institutional Source Beutler Lab
Gene Symbol Th
Ensembl Gene ENSMUSG00000000214
Gene Nametyrosine hydroxylase
Synonyms
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142892752-142931128 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 142894075 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 329 (Q329*)
Ref Sequence ENSEMBL: ENSMUSP00000101549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000219] [ENSMUST00000105929] [ENSMUST00000123057] [ENSMUST00000124951] [ENSMUST00000140344]
Predicted Effect probably null
Transcript: ENSMUST00000000219
AA Change: Q424*
SMART Domains Protein: ENSMUSP00000000219
Gene: ENSMUSG00000000214
AA Change: Q424*

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 2.3e-15 PFAM
Pfam:TOH_N 29 49 2.6e-11 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 1e-49 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 495 1.2e-180 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105929
AA Change: Q329*
SMART Domains Protein: ENSMUSP00000101549
Gene: ENSMUSG00000000214
AA Change: Q329*

DomainStartEndE-ValueType
PDB:2MDA|B 8 51 1e-21 PDB
low complexity region 52 63 N/A INTRINSIC
Pfam:Biopterin_H 70 401 2.2e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123057
Predicted Effect probably benign
Transcript: ENSMUST00000124951
SMART Domains Protein: ENSMUSP00000122876
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 5e-16 PFAM
Pfam:TOH_N 28 49 4.1e-10 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 2e-52 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 232 7.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138482
Predicted Effect probably benign
Transcript: ENSMUST00000140344
SMART Domains Protein: ENSMUSP00000115434
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 11 29 5.2e-9 PFAM
low complexity region 31 43 N/A INTRINSIC
PDB:2MDA|B 45 126 7e-53 PDB
low complexity region 127 138 N/A INTRINSIC
Pfam:Biopterin_H 145 171 3.9e-11 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in catecholamines, and usually die around embryonic day 11.5-15.5 due to cardiac failure. Treatment of the pregnant female with dihydroxyphenylalanine prevents prenatal mortality. Mice homozygous for hypomorphic targeted alleles are hypokinetic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Th
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Th APN 7 142897026 missense probably benign 0.01
IGL02308:Th APN 7 142898057 missense possibly damaging 0.69
IGL02417:Th APN 7 142899906 missense probably damaging 1.00
IGL02565:Th APN 7 142899910 missense probably damaging 1.00
IGL02896:Th APN 7 142895431 missense probably damaging 1.00
R0311:Th UTSW 7 142896041 missense probably damaging 1.00
R1072:Th UTSW 7 142894488 missense probably benign
R1595:Th UTSW 7 142897008 missense probably benign 0.06
R1756:Th UTSW 7 142898166 nonsense probably null
R2091:Th UTSW 7 142895543 missense probably damaging 0.98
R2850:Th UTSW 7 142894075 nonsense probably null
R4458:Th UTSW 7 142896953 missense probably benign 0.41
R4870:Th UTSW 7 142894097 missense probably benign
R5382:Th UTSW 7 142895440 missense probably damaging 1.00
R7874:Th UTSW 7 142895571 nonsense probably null
R8049:Th UTSW 7 142894123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGGTAATCTCAAGCATGAAC -3'
(R):5'- TCTAGAGAGTGTATGCCTCTGG -3'

Sequencing Primer
(F):5'- GGGTAATCTCAAGCATGAACTCTTG -3'
(R):5'- TGGCCAGACCCCACTGTAC -3'
Posted On2015-02-05