Incidental Mutation 'R3151:Olfr402'
ID264418
Institutional Source Beutler Lab
Gene Symbol Olfr402
Ensembl Gene ENSMUSG00000070379
Gene Nameolfactory receptor 402
SynonymsMOR255-4, GA_x6K02T2P1NL-4307199-4308146
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3151 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74153529-74158161 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74155640 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 162 (H162L)
Ref Sequence ENSEMBL: ENSMUSP00000151050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073675] [ENSMUST00000216722]
Predicted Effect probably damaging
Transcript: ENSMUST00000073675
AA Change: H162L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073356
Gene: ENSMUSG00000070379
AA Change: H162L

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 210 2.2e-6 PFAM
Pfam:7tm_1 44 293 9.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216722
AA Change: H162L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.5844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trio A G 15: 27,805,776 L542P probably damaging Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Olfr402
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Olfr402 APN 11 74155453 missense probably damaging 1.00
IGL03085:Olfr402 APN 11 74155685 missense probably damaging 1.00
IGL03192:Olfr402 APN 11 74155250 missense probably benign 0.13
IGL03230:Olfr402 APN 11 74155273 missense probably benign
R1478:Olfr402 UTSW 11 74155137 splice site probably null
R1573:Olfr402 UTSW 11 74155370 missense probably benign 0.11
R1728:Olfr402 UTSW 11 74155976 missense probably damaging 0.99
R1912:Olfr402 UTSW 11 74155885 missense probably damaging 1.00
R2030:Olfr402 UTSW 11 74155943 missense possibly damaging 0.94
R4428:Olfr402 UTSW 11 74155199 missense probably damaging 1.00
R4796:Olfr402 UTSW 11 74155591 missense probably benign 0.02
R4974:Olfr402 UTSW 11 74155919 missense probably benign 0.42
R4996:Olfr402 UTSW 11 74155331 missense probably damaging 1.00
R5308:Olfr402 UTSW 11 74155571 missense probably damaging 0.99
R5912:Olfr402 UTSW 11 74155220 missense possibly damaging 0.64
R6083:Olfr402 UTSW 11 74155570 missense possibly damaging 0.92
R7131:Olfr402 UTSW 11 74155780 missense probably benign 0.02
R7460:Olfr402 UTSW 11 74155846 missense probably damaging 0.99
R7540:Olfr402 UTSW 11 74155588 missense probably benign 0.00
R7795:Olfr402 UTSW 11 74156018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATGGAGACTGCCTCAC -3'
(R):5'- AGAACTGCAGCTGCCACATG -3'

Sequencing Primer
(F):5'- TATGGAGACTGCCTCACACAGC -3'
(R):5'- CTGCAGCTGCCACATGGATATAAG -3'
Posted On2015-02-05