Incidental Mutation 'R3151:Trio'
ID264427
Institutional Source Beutler Lab
Gene Symbol Trio
Ensembl Gene ENSMUSG00000022263
Gene Nametriple functional domain (PTPRF interacting)
SynonymsSolo, 6720464I07Rik
MMRRC Submission 040603-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3151 (G1)
Quality Score204
Status Validated
Chromosome15
Chromosomal Location27730651-28025848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27805776 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 542 (L542P)
Ref Sequence ENSEMBL: ENSMUSP00000154309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644] [ENSMUST00000227337]
Predicted Effect probably damaging
Transcript: ENSMUST00000090247
AA Change: L1686P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: L1686P

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
SEC14 68 207 3.4e-26 SMART
SPEC 221 337 2.48e-9 SMART
SPEC 343 445 1.92e-15 SMART
SPEC 569 671 5.35e-14 SMART
SPEC 674 783 1.18e-6 SMART
SPEC 910 1011 2.6e-12 SMART
SPEC 1141 1243 7e-18 SMART
low complexity region 1249 1258 N/A INTRINSIC
RhoGEF 1296 1466 2.79e-53 SMART
PH 1480 1593 1.53e-9 SMART
SH3 1659 1720 1.9e-8 SMART
low complexity region 1788 1802 N/A INTRINSIC
low complexity region 1837 1863 N/A INTRINSIC
low complexity region 1936 1954 N/A INTRINSIC
RhoGEF 1973 2144 1.32e-63 SMART
PH 2158 2273 3.6e-6 SMART
low complexity region 2291 2341 N/A INTRINSIC
low complexity region 2371 2390 N/A INTRINSIC
low complexity region 2491 2503 N/A INTRINSIC
SH3 2558 2619 1.04e0 SMART
low complexity region 2640 2660 N/A INTRINSIC
IGc2 2701 2770 4e-12 SMART
S_TKc 2800 3054 4.84e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226644
AA Change: L542P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227337
AA Change: L1627P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.9463 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,781,631 Y587H probably damaging Het
Ahnak T C 19: 9,009,944 V2864A probably benign Het
Ano2 G A 6: 126,013,317 probably null Het
Arl5c A G 11: 97,992,333 I147T probably damaging Het
Asap2 T A 12: 21,224,377 F369I probably damaging Het
Atg4a-ps A G 3: 103,645,912 F38L probably benign Het
B230217C12Rik TGTGTCG TG 11: 97,842,188 probably null Het
Cacna1s A T 1: 136,105,794 Y1003F probably damaging Het
Ccdc178 A T 18: 21,811,561 M847K probably benign Het
Clca4b T C 3: 144,915,511 K601E probably benign Het
Cnih4 A G 1: 181,153,727 probably benign Het
Cnpy3 A T 17: 46,747,526 V57E probably damaging Het
Creb3l1 T A 2: 92,002,033 E48V probably damaging Het
Dus3l T A 17: 56,768,899 F482I probably benign Het
Dync1i2 A G 2: 71,233,716 probably benign Het
Echdc1 A G 10: 29,322,364 T102A possibly damaging Het
Elf1 G A 14: 79,567,315 probably null Het
Ep400 G T 5: 110,703,569 T1349N unknown Het
Eps15 T A 4: 109,366,222 D458E probably benign Het
F2rl2 G A 13: 95,701,130 V228I probably benign Het
Fads3 T G 19: 10,057,898 S438A probably benign Het
Fcgbp T A 7: 28,117,240 C2376S probably damaging Het
Fndc3b A G 3: 27,419,503 S1138P possibly damaging Het
Ggt5 T C 10: 75,609,242 I361T probably benign Het
Gpr158 C T 2: 21,576,960 R417W possibly damaging Het
Gria1 A G 11: 57,283,562 I626V probably damaging Het
Gys2 T C 6: 142,456,333 E260G probably benign Het
Ido2 T A 8: 24,533,760 Y354F possibly damaging Het
Igkv6-23 A G 6: 70,260,559 L66P probably benign Het
Ikbkap T C 4: 56,770,985 Y986C probably benign Het
Kremen1 T C 11: 5,195,012 K455E probably damaging Het
Krtap19-9b T C 16: 88,932,208 S2G unknown Het
Magea1 A T X: 155,089,097 M211K probably benign Het
Mtx2 G A 2: 74,847,290 probably null Het
Nlrp14 G A 7: 107,182,552 V319I probably benign Het
Nphs1 A T 7: 30,460,240 T33S probably benign Het
Olfr402 A T 11: 74,155,640 H162L probably damaging Het
Olfr527 A T 7: 140,336,330 H156L probably benign Het
Olfr720 T A 14: 14,175,203 N293I probably damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pclo A G 5: 14,521,678 Q359R probably damaging Het
Phtf2 T C 5: 20,765,804 E147G probably damaging Het
Ptges2 G A 2: 32,396,476 A68T probably benign Het
Rab33b A T 3: 51,493,648 N181I possibly damaging Het
Rnf213 A T 11: 119,468,892 R4370S probably benign Het
Rpf1 G A 3: 146,507,635 R254W probably damaging Het
Serpinb7 A T 1: 107,435,351 R82* probably null Het
Setbp1 A G 18: 78,857,435 S1006P probably damaging Het
Spata31d1a T C 13: 59,701,366 S983G probably benign Het
Ssr2 T C 3: 88,580,016 I46T probably damaging Het
Ssx2ip G A 3: 146,418,383 G51D probably benign Het
Synj1 A T 16: 90,960,626 L878H probably damaging Het
Th G A 7: 142,894,075 Q329* probably null Het
Tln2 C T 9: 67,330,547 probably null Het
Trp53bp2 A G 1: 182,428,960 T32A probably damaging Het
Vmn1r40 A T 6: 89,714,566 T122S probably benign Het
Vmn2r121 C T X: 124,131,152 C494Y probably benign Het
Vmn2r51 A T 7: 10,100,041 Y357N probably damaging Het
Vmn2r55 G T 7: 12,670,707 S256R probably benign Het
Vps8 A G 16: 21,442,373 T88A probably benign Het
Zfp977 A C 7: 42,580,446 N218K probably benign Het
Other mutations in Trio
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Trio APN 15 27912743 splice site probably benign
IGL01011:Trio APN 15 27736489 missense probably damaging 0.96
IGL01090:Trio APN 15 27773007 missense probably damaging 1.00
IGL01145:Trio APN 15 27818167 splice site probably benign
IGL01147:Trio APN 15 27881320 missense probably damaging 1.00
IGL01161:Trio APN 15 27749781 missense probably damaging 1.00
IGL01324:Trio APN 15 27905323 missense probably benign 0.42
IGL01352:Trio APN 15 27901229 missense probably benign 0.01
IGL01366:Trio APN 15 27732868 missense possibly damaging 0.76
IGL01443:Trio APN 15 27838775 splice site probably benign
IGL01454:Trio APN 15 27832985 missense probably benign 0.32
IGL01695:Trio APN 15 27773001 missense probably damaging 1.00
IGL01765:Trio APN 15 27764026 missense possibly damaging 0.85
IGL01860:Trio APN 15 27846810 missense probably damaging 1.00
IGL01879:Trio APN 15 27741033 missense probably benign 0.12
IGL01991:Trio APN 15 27871274 missense possibly damaging 0.95
IGL02106:Trio APN 15 27744158 missense possibly damaging 0.85
IGL02209:Trio APN 15 27744053 missense probably damaging 1.00
IGL02232:Trio APN 15 27902561 missense probably benign 0.24
IGL02304:Trio APN 15 27735436 missense probably damaging 0.96
IGL02504:Trio APN 15 27847390 nonsense probably null
IGL02508:Trio APN 15 27818104 missense possibly damaging 0.65
IGL02541:Trio APN 15 27844930 splice site probably benign
IGL02617:Trio APN 15 27841849 splice site probably benign
IGL02675:Trio APN 15 27768039 unclassified probably benign
IGL02817:Trio APN 15 27902881 missense probably benign 0.01
IGL02993:Trio APN 15 27830239 splice site probably benign
IGL03007:Trio APN 15 27902742 missense probably damaging 0.99
IGL03135:Trio APN 15 27832011 splice site probably benign
IGL03225:Trio APN 15 27902695 missense probably benign 0.30
R0063:Trio UTSW 15 27881437 splice site probably benign
R0063:Trio UTSW 15 27881437 splice site probably benign
R0302:Trio UTSW 15 27902517 missense probably damaging 1.00
R0505:Trio UTSW 15 27767907 missense probably benign 0.00
R0506:Trio UTSW 15 27854963 missense probably benign 0.12
R0564:Trio UTSW 15 27805822 missense probably damaging 1.00
R0659:Trio UTSW 15 27831399 missense probably damaging 0.97
R0882:Trio UTSW 15 27732894 missense probably damaging 1.00
R0939:Trio UTSW 15 27741250 critical splice donor site probably null
R1018:Trio UTSW 15 27871171 missense probably damaging 1.00
R1439:Trio UTSW 15 27897914 missense probably damaging 1.00
R1456:Trio UTSW 15 27753804 splice site probably benign
R1488:Trio UTSW 15 27740967 missense probably damaging 1.00
R1522:Trio UTSW 15 27732640 missense probably benign 0.28
R1531:Trio UTSW 15 27832985 missense probably benign 0.32
R1640:Trio UTSW 15 27833044 missense probably damaging 1.00
R1646:Trio UTSW 15 27758347 missense possibly damaging 0.91
R1682:Trio UTSW 15 27744146 unclassified probably null
R1780:Trio UTSW 15 27744038 missense possibly damaging 0.93
R1791:Trio UTSW 15 27841756 missense probably damaging 1.00
R1803:Trio UTSW 15 27748340 missense probably benign
R1817:Trio UTSW 15 27742495 nonsense probably null
R1853:Trio UTSW 15 27756536 missense probably damaging 1.00
R1898:Trio UTSW 15 27742380 missense possibly damaging 0.52
R1937:Trio UTSW 15 27833056 missense probably damaging 1.00
R1938:Trio UTSW 15 27732891 missense probably damaging 0.98
R2025:Trio UTSW 15 27744137 missense probably damaging 0.99
R2025:Trio UTSW 15 27773927 missense probably damaging 1.00
R2050:Trio UTSW 15 27851945 missense possibly damaging 0.85
R2186:Trio UTSW 15 27823975 splice site probably null
R2913:Trio UTSW 15 27854912 missense probably damaging 1.00
R3771:Trio UTSW 15 27748091 missense probably damaging 0.98
R3773:Trio UTSW 15 27748091 missense probably damaging 0.98
R3826:Trio UTSW 15 27833070 missense probably damaging 1.00
R4015:Trio UTSW 15 27744101 missense possibly damaging 0.71
R4359:Trio UTSW 15 27749797 nonsense probably null
R4370:Trio UTSW 15 27748337 nonsense probably null
R4547:Trio UTSW 15 27818982 missense possibly damaging 0.89
R4573:Trio UTSW 15 27772998 small deletion probably benign
R4620:Trio UTSW 15 27871171 missense probably damaging 1.00
R4735:Trio UTSW 15 27752789 splice site probably null
R4764:Trio UTSW 15 27732538 nonsense probably null
R4775:Trio UTSW 15 27881342 nonsense probably null
R4942:Trio UTSW 15 27752725 missense probably benign 0.21
R5004:Trio UTSW 15 27755178 missense probably damaging 1.00
R5149:Trio UTSW 15 27754029 missense possibly damaging 0.74
R5183:Trio UTSW 15 27902600 missense probably benign 0.00
R5186:Trio UTSW 15 27897991 missense probably damaging 0.97
R5268:Trio UTSW 15 27748286 missense probably benign 0.02
R5344:Trio UTSW 15 27735532 missense probably benign 0.12
R5407:Trio UTSW 15 27844806 splice site probably null
R5442:Trio UTSW 15 27856194 missense probably benign 0.04
R5617:Trio UTSW 15 27902748 missense probably benign
R5778:Trio UTSW 15 27856164 missense probably benign 0.33
R5986:Trio UTSW 15 27851933 missense possibly damaging 0.88
R5990:Trio UTSW 15 27891459 missense probably benign 0.10
R6011:Trio UTSW 15 27735545 missense probably damaging 0.98
R6063:Trio UTSW 15 27891379 missense possibly damaging 0.94
R6166:Trio UTSW 15 27818071 missense probably damaging 0.96
R6187:Trio UTSW 15 27743952 critical splice donor site probably null
R6387:Trio UTSW 15 27752739 missense probably damaging 1.00
R6402:Trio UTSW 15 27902911 missense probably benign 0.02
R6478:Trio UTSW 15 27856107 missense probably benign 0.01
R6528:Trio UTSW 15 27805870 missense probably damaging 1.00
R6662:Trio UTSW 15 27854996 missense probably benign 0.00
R6825:Trio UTSW 15 27889308 missense probably damaging 0.98
R6890:Trio UTSW 15 27919288 unclassified probably benign
R6945:Trio UTSW 15 27824090 missense probably damaging 1.00
R7027:Trio UTSW 15 27805654 missense possibly damaging 0.86
R7046:Trio UTSW 15 27832051 missense probably damaging 1.00
R7049:Trio UTSW 15 27749799 missense possibly damaging 0.66
R7075:Trio UTSW 15 27898000 missense unknown
R7094:Trio UTSW 15 27891448 missense unknown
R7123:Trio UTSW 15 27742313 critical splice donor site probably benign
R7130:Trio UTSW 15 27742313 critical splice donor site probably benign
R7214:Trio UTSW 15 27871187 missense probably damaging 0.97
R7292:Trio UTSW 15 27828351 missense possibly damaging 0.63
R7293:Trio UTSW 15 27871289 missense possibly damaging 0.66
R7352:Trio UTSW 15 27732876 missense probably damaging 0.96
R7426:Trio UTSW 15 27856107 missense probably benign 0.01
R7451:Trio UTSW 15 27747913 missense probably benign 0.07
R7558:Trio UTSW 15 27831394 missense possibly damaging 0.90
R7578:Trio UTSW 15 27854939 missense possibly damaging 0.94
R7596:Trio UTSW 15 27749826 missense probably damaging 0.99
R7604:Trio UTSW 15 27736445 critical splice donor site probably null
R7609:Trio UTSW 15 27912642 missense unknown
R7767:Trio UTSW 15 27889418 missense unknown
R7784:Trio UTSW 15 27763994 missense probably damaging 1.00
R7817:Trio UTSW 15 27749866 missense probably benign 0.35
R7833:Trio UTSW 15 27774086 missense probably damaging 0.99
R7873:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7879:Trio UTSW 15 27851924 missense possibly damaging 0.94
R7916:Trio UTSW 15 27774086 missense probably damaging 0.99
R7956:Trio UTSW 15 27805684 missense possibly damaging 0.83
R7962:Trio UTSW 15 27851924 missense possibly damaging 0.94
R8022:Trio UTSW 15 27749866 missense probably benign 0.35
R8050:Trio UTSW 15 27891454 missense unknown
X0024:Trio UTSW 15 27765726 missense possibly damaging 0.91
Z1176:Trio UTSW 15 27771387 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCCATTGCAGAGCCGAAG -3'
(R):5'- CCTAGCCAAGTTCGTAACTGTG -3'

Sequencing Primer
(F):5'- TCCTGTGTGCTCAGCTGCAG -3'
(R):5'- AACTGTGTCCATCTACGTGG -3'
Posted On2015-02-05