Incidental Mutation 'R3153:Abhd12'
ID264444
Institutional Source Beutler Lab
Gene Symbol Abhd12
Ensembl Gene ENSMUSG00000032046
Gene Nameabhydrolase domain containing 12
Synonyms
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150832493-150904741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150834355 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 361 (F361L)
Ref Sequence ENSEMBL: ENSMUSP00000053558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441] [ENSMUST00000056149] [ENSMUST00000141899]
Predicted Effect probably benign
Transcript: ENSMUST00000045441
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056149
AA Change: F361L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000053558
Gene: ENSMUSG00000032046
AA Change: F361L

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Hydrolase_4 165 297 1.2e-16 PFAM
Pfam:Abhydrolase_1 169 302 1.6e-13 PFAM
Pfam:Abhydrolase_5 170 359 2.5e-22 PFAM
Pfam:Abhydrolase_6 171 363 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138608
Predicted Effect probably benign
Transcript: ENSMUST00000141899
SMART Domains Protein: ENSMUSP00000122763
Gene: ENSMUSG00000032046

DomainStartEndE-ValueType
low complexity region 15 36 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Abhydrolase_5 170 295 1.9e-16 PFAM
Pfam:Abhydrolase_6 171 293 3.8e-15 PFAM
Pfam:Abhydrolase_3 171 295 1.1e-6 PFAM
Pfam:Abhydrolase_1 198 271 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156641
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurological symptoms of neurodegeneration, hearing loss, ataxia, microgliosis and reduced brain lysophosphatidylserine lipase activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Abhd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Abhd12 APN 2 150848421 missense probably benign 0.00
IGL02399:Abhd12 APN 2 150858493 splice site probably benign
IGL02437:Abhd12 APN 2 150834369 missense probably benign 0.01
IGL02981:Abhd12 APN 2 150833124 missense probably benign
R0423:Abhd12 UTSW 2 150838392 missense possibly damaging 0.89
R0617:Abhd12 UTSW 2 150846365 critical splice acceptor site probably null
R0745:Abhd12 UTSW 2 150833148 splice site probably null
R1651:Abhd12 UTSW 2 150848421 missense probably benign 0.00
R1829:Abhd12 UTSW 2 150843398 missense probably damaging 1.00
R1832:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R1833:Abhd12 UTSW 2 150848418 missense probably damaging 0.97
R2298:Abhd12 UTSW 2 150901494 intron probably benign
R4077:Abhd12 UTSW 2 150848459 critical splice acceptor site probably null
R4508:Abhd12 UTSW 2 150904355 critical splice donor site probably benign
R5193:Abhd12 UTSW 2 150835306 makesense probably null
R5898:Abhd12 UTSW 2 150839778 missense possibly damaging 0.89
R6250:Abhd12 UTSW 2 150839747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAATGGCTTCAGTGAC -3'
(R):5'- TGCCTAGCATTCCCAGACTC -3'

Sequencing Primer
(F):5'- GTGACTGTCACTTGCTGCACAG -3'
(R):5'- AGACTCTGGCTTCTTGGACCTG -3'
Posted On2015-02-05