Mutagenetix > Incidental Mutation

Incidental Mutation 'R3153:Fancd2'

264464

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

040604-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3153 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113593269 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 1394 (S1394G)

Ref Sequence

ENSEMBL: ENSMUSP00000144928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035870] [ENSMUST00000036340] [ENSMUST00000125139] [ENSMUST00000204827]

AlphaFold

Q80V62

Predicted Effect

probably benign
Transcript: ENSMUST00000035870

SMART Domains

Protein: ENSMUSP00000035316
Gene: ENSMUSG00000033963

Domain	Start	End	E-Value	Type
Pfam:DUF4563	3	178	1.4e-99	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036340
AA Change: S1407G

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: S1407G

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125139

SMART Domains

Protein: ENSMUSP00000121804
Gene: ENSMUSG00000033963

Domain	Start	End	E-Value	Type
Pfam:DUF4563	1	178	5.2e-109	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204827
AA Change: S1394G

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: S1394G

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,440,824	N200H	probably damaging	Het
Abca17	T	A	17: 24,328,746	D218V	probably damaging	Het
Abhd12	A	G	2: 150,834,355	F361L	probably benign	Het
Abr	A	T	11: 76,486,469	I59N	probably damaging	Het
Agbl1	A	G	7: 76,720,196	E681G	probably damaging	Het
B3gnt4	G	T	5: 123,510,653	R27L	probably benign	Het
Cct8l1	A	C	5: 25,517,139	E284A	probably damaging	Het
Chd7	T	A	4: 8,855,174	N2134K	probably benign	Het
Chrna3	C	T	9: 55,016,050	C158Y	probably damaging	Het
Cndp2	C	A	18: 84,668,597	M433I	probably benign	Het
Cnnm3	T	A	1: 36,521,222	S608T	probably damaging	Het
Cnot1	T	C	8: 95,744,278	E1314G	possibly damaging	Het
Col20a1	C	T	2: 181,008,593	P1074L	probably damaging	Het
Coq6	G	A	12: 84,371,535	V298M	probably damaging	Het
Cpt1a	A	G	19: 3,356,430	Y132C	probably damaging	Het
Dcdc2a	A	C	13: 25,102,357	I125L	probably benign	Het
Eps8l1	A	T	7: 4,471,799	I321F	probably damaging	Het
Fcrl5	T	C	3: 87,443,680	F166L	probably benign	Het
Gatc	T	C	5: 115,335,487	E131G	probably benign	Het
Gpld1	T	C	13: 24,943,620	S2P	unknown	Het
Gprc5b	G	A	7: 118,976,547	P385L	probably damaging	Het
Gsc2	G	A	16: 17,914,500	R137W	probably damaging	Het
Hsd3b1	T	C	3: 98,852,664	D337G	probably damaging	Het
Ireb2	T	C	9: 54,885,946		probably null	Het
Kank1	T	A	19: 25,410,688	V575E	possibly damaging	Het
Kcnmb1	A	T	11: 33,966,339	D95V	probably damaging	Het
L3mbtl4	T	A	17: 68,457,248	Y125*	probably null	Het
Lce1h	C	T	3: 92,763,675	G57R	unknown	Het
Lgalsl	A	G	11: 20,826,487	F135S	probably damaging	Het
Lrba	A	G	3: 86,285,219	M147V	probably damaging	Het
Mdm2	T	C	10: 117,709,713	E23G	possibly damaging	Het
Mthfd1	C	A	12: 76,311,963	Q67K	probably benign	Het
Mtus2	T	C	5: 148,083,060	L755P	probably damaging	Het
Olfr1026	T	C	2: 85,923,730	V154A	probably benign	Het
Orc3	A	G	4: 34,575,124	F587L	probably damaging	Het
Pcdhb7	C	T	18: 37,343,073	P421S	probably damaging	Het
Pgk2	T	A	17: 40,208,243	D98V	probably damaging	Het
Pkd1l1	A	C	11: 8,867,207	S1364A	probably benign	Het
Rin3	A	C	12: 102,368,541	E157A	unknown	Het
Rnf126	A	T	10: 79,761,631	I149N	probably damaging	Het
Rph3a	T	C	5: 120,973,377	T47A	probably damaging	Het
Sap18	T	C	14: 57,801,945	M68T	probably benign	Het
Sfrp2	A	G	3: 83,773,270	T246A	probably benign	Het
Slc18a3	A	G	14: 32,463,271	V385A	probably benign	Het
Slitrk3	C	T	3: 73,048,982	W819*	probably null	Het
Smap1	A	T	1: 23,853,549	D111E	probably damaging	Het
Spesp1	G	A	9: 62,282,094		probably benign	Het
Styk1	A	T	6: 131,310,012	Y84*	probably null	Het
Sv2a	T	A	3: 96,185,258	D91E	possibly damaging	Het
Tbc1d5	A	G	17: 50,968,236	I77T	probably damaging	Het
Trim10	T	A	17: 36,871,688	C149S	probably damaging	Het
Zbtb38	T	C	9: 96,688,249	K261E	probably benign	Het
Zfp202	T	C	9: 40,208,438	L179P	probably benign	Het
Zkscan5	T	A	5: 145,212,627	S251R	probably benign	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5782:Fancd2	UTSW	6	113548872	missense	probably benign	0.00
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCTTCCCTGAATGATAGGTCAGAG -3'
(R):5'- TGGATCCCAAAGCATTCATGTAAG -3'

Sequencing Primer
(F):5'- AGGTTGAAGGGCTAGAATATTGCTTC -3'
(R):5'- TTGGTAGGGAATGGAGATGGGC -3'

Posted On

2015-02-05