Incidental Mutation 'R3153:Eps8l1'
ID264466
Institutional Source Beutler Lab
Gene Symbol Eps8l1
Ensembl Gene ENSMUSG00000006154
Gene NameEPS8-like 1
Synonyms4632407K17Rik, 2310051G19Rik, DRC3, EPS8R1
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4460674-4480487 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4471799 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 321 (I321F)
Ref Sequence ENSEMBL: ENSMUSP00000133206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086372] [ENSMUST00000163137] [ENSMUST00000163804] [ENSMUST00000163893] [ENSMUST00000167298] [ENSMUST00000167810] [ENSMUST00000169820] [ENSMUST00000170635] [ENSMUST00000171445]
Predicted Effect probably damaging
Transcript: ENSMUST00000086372
AA Change: I260F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154
AA Change: I260F

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146199
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163804
Predicted Effect probably damaging
Transcript: ENSMUST00000163893
AA Change: I260F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154
AA Change: I260F

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167068
Predicted Effect probably benign
Transcript: ENSMUST00000167298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167599
Predicted Effect probably benign
Transcript: ENSMUST00000167810
SMART Domains Protein: ENSMUSP00000126720
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 152 5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169820
SMART Domains Protein: ENSMUSP00000131773
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 93 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170423
Predicted Effect probably benign
Transcript: ENSMUST00000170635
SMART Domains Protein: ENSMUSP00000127999
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
PDB:2CY5|A 26 52 3e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000171445
AA Change: I321F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154
AA Change: I321F

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171665
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. At least two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Dcdc2a A C 13: 25,102,357 I125L probably benign Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Eps8l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Eps8l1 APN 7 4478920 utr 3 prime probably benign
IGL01455:Eps8l1 APN 7 4478923 utr 3 prime probably benign
IGL01872:Eps8l1 APN 7 4472296 splice site probably benign
IGL02343:Eps8l1 APN 7 4472124 missense probably benign 0.04
IGL02585:Eps8l1 APN 7 4469213 missense probably damaging 1.00
IGL02596:Eps8l1 APN 7 4470872 missense probably damaging 0.99
IGL02673:Eps8l1 APN 7 4478732 missense probably damaging 1.00
IGL03117:Eps8l1 APN 7 4470887 missense probably damaging 1.00
anamnestic UTSW 7 4470874 missense probably damaging 0.98
souvenir UTSW 7 4477896 missense possibly damaging 0.56
PIT4142001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4151001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
PIT4480001:Eps8l1 UTSW 7 4471415 missense probably benign 0.00
R0015:Eps8l1 UTSW 7 4477557 splice site probably benign
R0599:Eps8l1 UTSW 7 4477957 missense possibly damaging 0.90
R0686:Eps8l1 UTSW 7 4477450 missense probably benign 0.36
R0827:Eps8l1 UTSW 7 4477389 missense possibly damaging 0.86
R1015:Eps8l1 UTSW 7 4469933 missense probably damaging 1.00
R1447:Eps8l1 UTSW 7 4474056 missense probably damaging 1.00
R1490:Eps8l1 UTSW 7 4470889 missense probably damaging 1.00
R1527:Eps8l1 UTSW 7 4471394 missense probably benign
R1553:Eps8l1 UTSW 7 4477449 missense probably damaging 0.98
R1763:Eps8l1 UTSW 7 4471823 missense probably benign 0.43
R1863:Eps8l1 UTSW 7 4465360 utr 5 prime probably benign
R2357:Eps8l1 UTSW 7 4470355 missense probably benign 0.06
R4082:Eps8l1 UTSW 7 4470798 splice site probably null
R4539:Eps8l1 UTSW 7 4478624 missense probably damaging 1.00
R4684:Eps8l1 UTSW 7 4473945 missense probably damaging 0.99
R4930:Eps8l1 UTSW 7 4460916 missense possibly damaging 0.66
R4931:Eps8l1 UTSW 7 4471241 missense possibly damaging 0.95
R5245:Eps8l1 UTSW 7 4470874 missense probably damaging 0.98
R5247:Eps8l1 UTSW 7 4470402 missense probably damaging 1.00
R5305:Eps8l1 UTSW 7 4477896 missense possibly damaging 0.56
R5420:Eps8l1 UTSW 7 4470161 intron probably null
R5620:Eps8l1 UTSW 7 4460946 missense possibly damaging 0.83
R5705:Eps8l1 UTSW 7 4470035 missense probably benign 0.00
R6063:Eps8l1 UTSW 7 4471297 missense possibly damaging 0.56
R6909:Eps8l1 UTSW 7 4469900 nonsense probably null
R7096:Eps8l1 UTSW 7 4474191 missense probably benign 0.01
R7136:Eps8l1 UTSW 7 4477404 missense probably damaging 1.00
R7144:Eps8l1 UTSW 7 4472185 missense probably damaging 1.00
R7539:Eps8l1 UTSW 7 4470037 missense probably damaging 1.00
X0060:Eps8l1 UTSW 7 4470851 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGATTCAGGAACGTGGCAC -3'
(R):5'- TCACTCAGGAAGGTGTGTTC -3'

Sequencing Primer
(F):5'- CACGTCTAGGTGTGACTAGCTGAC -3'
(R):5'- CAGGAAGGTGTGTTCTCGGTCC -3'
Posted On2015-02-05