Incidental Mutation 'R3153:Dcdc2a'
ID264488
Institutional Source Beutler Lab
Gene Symbol Dcdc2a
Ensembl Gene ENSMUSG00000035910
Gene Namedoublecortin domain containing 2a
SynonymsRU2, Dcdc2
MMRRC Submission 040604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R3153 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location25056004-25210706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25102357 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 125 (I125L)
Ref Sequence ENSEMBL: ENSMUSP00000047641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036932] [ENSMUST00000069614]
Predicted Effect probably benign
Transcript: ENSMUST00000036932
AA Change: I125L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000047641
Gene: ENSMUSG00000035910
AA Change: I125L

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069614
AA Change: I125L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000063650
Gene: ENSMUSG00000035910
AA Change: I125L

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
coiled coil region 409 437 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159129
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired short term object recognition, impaired visuo-spatial learning and memory and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,440,824 N200H probably damaging Het
Abca17 T A 17: 24,328,746 D218V probably damaging Het
Abhd12 A G 2: 150,834,355 F361L probably benign Het
Abr A T 11: 76,486,469 I59N probably damaging Het
Agbl1 A G 7: 76,720,196 E681G probably damaging Het
B3gnt4 G T 5: 123,510,653 R27L probably benign Het
Cct8l1 A C 5: 25,517,139 E284A probably damaging Het
Chd7 T A 4: 8,855,174 N2134K probably benign Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cndp2 C A 18: 84,668,597 M433I probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Col20a1 C T 2: 181,008,593 P1074L probably damaging Het
Coq6 G A 12: 84,371,535 V298M probably damaging Het
Cpt1a A G 19: 3,356,430 Y132C probably damaging Het
Eps8l1 A T 7: 4,471,799 I321F probably damaging Het
Fancd2 A G 6: 113,593,269 S1394G possibly damaging Het
Fcrl5 T C 3: 87,443,680 F166L probably benign Het
Gatc T C 5: 115,335,487 E131G probably benign Het
Gpld1 T C 13: 24,943,620 S2P unknown Het
Gprc5b G A 7: 118,976,547 P385L probably damaging Het
Gsc2 G A 16: 17,914,500 R137W probably damaging Het
Hsd3b1 T C 3: 98,852,664 D337G probably damaging Het
Ireb2 T C 9: 54,885,946 probably null Het
Kank1 T A 19: 25,410,688 V575E possibly damaging Het
Kcnmb1 A T 11: 33,966,339 D95V probably damaging Het
L3mbtl4 T A 17: 68,457,248 Y125* probably null Het
Lce1h C T 3: 92,763,675 G57R unknown Het
Lgalsl A G 11: 20,826,487 F135S probably damaging Het
Lrba A G 3: 86,285,219 M147V probably damaging Het
Mdm2 T C 10: 117,709,713 E23G possibly damaging Het
Mthfd1 C A 12: 76,311,963 Q67K probably benign Het
Mtus2 T C 5: 148,083,060 L755P probably damaging Het
Olfr1026 T C 2: 85,923,730 V154A probably benign Het
Orc3 A G 4: 34,575,124 F587L probably damaging Het
Pcdhb7 C T 18: 37,343,073 P421S probably damaging Het
Pgk2 T A 17: 40,208,243 D98V probably damaging Het
Pkd1l1 A C 11: 8,867,207 S1364A probably benign Het
Rin3 A C 12: 102,368,541 E157A unknown Het
Rnf126 A T 10: 79,761,631 I149N probably damaging Het
Rph3a T C 5: 120,973,377 T47A probably damaging Het
Sap18 T C 14: 57,801,945 M68T probably benign Het
Sfrp2 A G 3: 83,773,270 T246A probably benign Het
Slc18a3 A G 14: 32,463,271 V385A probably benign Het
Slitrk3 C T 3: 73,048,982 W819* probably null Het
Smap1 A T 1: 23,853,549 D111E probably damaging Het
Spesp1 G A 9: 62,282,094 probably benign Het
Styk1 A T 6: 131,310,012 Y84* probably null Het
Sv2a T A 3: 96,185,258 D91E possibly damaging Het
Tbc1d5 A G 17: 50,968,236 I77T probably damaging Het
Trim10 T A 17: 36,871,688 C149S probably damaging Het
Zbtb38 T C 9: 96,688,249 K261E probably benign Het
Zfp202 T C 9: 40,208,438 L179P probably benign Het
Zkscan5 T A 5: 145,212,627 S251R probably benign Het
Other mutations in Dcdc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Dcdc2a APN 13 25119329 missense probably benign 0.00
IGL01314:Dcdc2a APN 13 25102604 missense probably damaging 1.00
IGL02171:Dcdc2a APN 13 25056434 missense probably damaging 1.00
IGL02490:Dcdc2a APN 13 25107652 missense probably damaging 1.00
R0128:Dcdc2a UTSW 13 25187672 splice site probably benign
R0130:Dcdc2a UTSW 13 25187672 splice site probably benign
R0366:Dcdc2a UTSW 13 25056434 missense probably damaging 1.00
R0507:Dcdc2a UTSW 13 25102589 missense probably damaging 0.99
R0514:Dcdc2a UTSW 13 25119386 missense probably benign 0.04
R1055:Dcdc2a UTSW 13 25102610 missense probably damaging 0.99
R1170:Dcdc2a UTSW 13 25056307 missense probably benign 0.34
R1301:Dcdc2a UTSW 13 25102586 missense possibly damaging 0.93
R1514:Dcdc2a UTSW 13 25061254 missense probably benign 0.05
R1842:Dcdc2a UTSW 13 25107602 missense probably damaging 1.00
R2060:Dcdc2a UTSW 13 25107710 missense possibly damaging 0.59
R2121:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2122:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2900:Dcdc2a UTSW 13 25120498 missense probably benign 0.01
R3154:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R4353:Dcdc2a UTSW 13 25056491 missense probably damaging 1.00
R4608:Dcdc2a UTSW 13 25061240 nonsense probably null
R5099:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R5128:Dcdc2a UTSW 13 25102529 missense probably damaging 1.00
R5181:Dcdc2a UTSW 13 25202364 missense possibly damaging 0.94
R5271:Dcdc2a UTSW 13 25187688 missense probably benign 0.35
R5869:Dcdc2a UTSW 13 25107730 missense probably benign 0.05
R6058:Dcdc2a UTSW 13 25056371 missense possibly damaging 0.82
R6146:Dcdc2a UTSW 13 25205457 missense probably benign 0.35
R6892:Dcdc2a UTSW 13 25056460 missense probably damaging 1.00
R6956:Dcdc2a UTSW 13 25119366 missense probably benign 0.02
R6972:Dcdc2a UTSW 13 25120389 intron probably benign
R6973:Dcdc2a UTSW 13 25120389 intron probably benign
R7097:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R7247:Dcdc2a UTSW 13 25102391 missense probably benign 0.00
R7390:Dcdc2a UTSW 13 25107617 missense possibly damaging 0.89
R7570:Dcdc2a UTSW 13 25119373 missense probably benign
R7636:Dcdc2a UTSW 13 25102622 missense probably damaging 1.00
R7644:Dcdc2a UTSW 13 25107691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCAGGCCTTGAAGAG -3'
(R):5'- TGCAATCAAGCTGTGAGGG -3'

Sequencing Primer
(F):5'- TTAGTACATCCGGACCATGGTCAAG -3'
(R):5'- CAATCAAGCTGTGAGGGGAAAAG -3'
Posted On2015-02-05