Mutagenetix > Incidental Mutations

Incidental Mutation 'R3153:Kank1'

264505

Institutional Source

Beutler Lab

Gene Symbol

Kank1

Ensembl Gene

ENSMUSG00000032702

Gene Name

KN motif and ankyrin repeat domains 1

Synonyms

D330024H06Rik, Ankrd15, A930031B09Rik

MMRRC Submission

040604-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3153 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25236975-25434496 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25410688 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 575 (V575E)

Ref Sequence

ENSEMBL: ENSMUSP00000116660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]

Predicted Effect

probably benign
Transcript: ENSMUST00000049400
AA Change: V547E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: V547E

Domain	Start	End	E-Value	Type
Pfam:KN_motif	30	68	3.3e-24	PFAM
low complexity region	88	105	N/A	INTRINSIC
low complexity region	138	148	N/A	INTRINSIC
coiled coil region	286	314	N/A	INTRINSIC
low complexity region	350	358	N/A	INTRINSIC
coiled coil region	362	395	N/A	INTRINSIC
coiled coil region	451	494	N/A	INTRINSIC
low complexity region	541	556	N/A	INTRINSIC
low complexity region	617	629	N/A	INTRINSIC
Blast:ANK	963	993	7e-10	BLAST
low complexity region	1010	1030	N/A	INTRINSIC
low complexity region	1074	1095	N/A	INTRINSIC
ANK	1169	1199	3.71e-4	SMART
ANK	1203	1236	2.27e1	SMART
ANK	1241	1270	1.33e-5	SMART
ANK	1274	1306	5.84e-2	SMART
ANK	1308	1336	4.86e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137260

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146647
AA Change: V575E

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: V575E

Domain	Start	End	E-Value	Type
Pfam:KN_motif	58	96	2e-25	PFAM
low complexity region	116	133	N/A	INTRINSIC
low complexity region	166	176	N/A	INTRINSIC
coiled coil region	314	342	N/A	INTRINSIC
low complexity region	378	386	N/A	INTRINSIC
coiled coil region	390	423	N/A	INTRINSIC
internal_repeat_1	430	479	3.72e-5	PROSPERO
low complexity region	569	584	N/A	INTRINSIC
internal_repeat_1	587	636	3.72e-5	PROSPERO
low complexity region	645	657	N/A	INTRINSIC
Blast:ANK	991	1021	4e-10	BLAST
low complexity region	1038	1058	N/A	INTRINSIC
low complexity region	1102	1123	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,440,824	N200H	probably damaging	Het
Abca17	T	A	17: 24,328,746	D218V	probably damaging	Het
Abhd12	A	G	2: 150,834,355	F361L	probably benign	Het
Abr	A	T	11: 76,486,469	I59N	probably damaging	Het
Agbl1	A	G	7: 76,720,196	E681G	probably damaging	Het
B3gnt4	G	T	5: 123,510,653	R27L	probably benign	Het
Cct8l1	A	C	5: 25,517,139	E284A	probably damaging	Het
Chd7	T	A	4: 8,855,174	N2134K	probably benign	Het
Chrna3	C	T	9: 55,016,050	C158Y	probably damaging	Het
Cndp2	C	A	18: 84,668,597	M433I	probably benign	Het
Cnnm3	T	A	1: 36,521,222	S608T	probably damaging	Het
Cnot1	T	C	8: 95,744,278	E1314G	possibly damaging	Het
Col20a1	C	T	2: 181,008,593	P1074L	probably damaging	Het
Coq6	G	A	12: 84,371,535	V298M	probably damaging	Het
Cpt1a	A	G	19: 3,356,430	Y132C	probably damaging	Het
Dcdc2a	A	C	13: 25,102,357	I125L	probably benign	Het
Eps8l1	A	T	7: 4,471,799	I321F	probably damaging	Het
Fancd2	A	G	6: 113,593,269	S1394G	possibly damaging	Het
Fcrl5	T	C	3: 87,443,680	F166L	probably benign	Het
Gatc	T	C	5: 115,335,487	E131G	probably benign	Het
Gpld1	T	C	13: 24,943,620	S2P	unknown	Het
Gprc5b	G	A	7: 118,976,547	P385L	probably damaging	Het
Gsc2	G	A	16: 17,914,500	R137W	probably damaging	Het
Hsd3b1	T	C	3: 98,852,664	D337G	probably damaging	Het
Ireb2	T	C	9: 54,885,946		probably null	Het
Kcnmb1	A	T	11: 33,966,339	D95V	probably damaging	Het
L3mbtl4	T	A	17: 68,457,248	Y125*	probably null	Het
Lce1h	C	T	3: 92,763,675	G57R	unknown	Het
Lgalsl	A	G	11: 20,826,487	F135S	probably damaging	Het
Lrba	A	G	3: 86,285,219	M147V	probably damaging	Het
Mdm2	T	C	10: 117,709,713	E23G	possibly damaging	Het
Mthfd1	C	A	12: 76,311,963	Q67K	probably benign	Het
Mtus2	T	C	5: 148,083,060	L755P	probably damaging	Het
Olfr1026	T	C	2: 85,923,730	V154A	probably benign	Het
Orc3	A	G	4: 34,575,124	F587L	probably damaging	Het
Pcdhb7	C	T	18: 37,343,073	P421S	probably damaging	Het
Pgk2	T	A	17: 40,208,243	D98V	probably damaging	Het
Pkd1l1	A	C	11: 8,867,207	S1364A	probably benign	Het
Rin3	A	C	12: 102,368,541	E157A	unknown	Het
Rnf126	A	T	10: 79,761,631	I149N	probably damaging	Het
Rph3a	T	C	5: 120,973,377	T47A	probably damaging	Het
Sap18	T	C	14: 57,801,945	M68T	probably benign	Het
Sfrp2	A	G	3: 83,773,270	T246A	probably benign	Het
Slc18a3	A	G	14: 32,463,271	V385A	probably benign	Het
Slitrk3	C	T	3: 73,048,982	W819*	probably null	Het
Smap1	A	T	1: 23,853,549	D111E	probably damaging	Het
Spesp1	G	A	9: 62,282,094		probably benign	Het
Styk1	A	T	6: 131,310,012	Y84*	probably null	Het
Sv2a	T	A	3: 96,185,258	D91E	possibly damaging	Het
Tbc1d5	A	G	17: 50,968,236	I77T	probably damaging	Het
Trim10	T	A	17: 36,871,688	C149S	probably damaging	Het
Zbtb38	T	C	9: 96,688,249	K261E	probably benign	Het
Zfp202	T	C	9: 40,208,438	L179P	probably benign	Het
Zkscan5	T	A	5: 145,212,627	S251R	probably benign	Het

Other mutations in Kank1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Kank1	APN	19	25411758	missense	probably benign
IGL00435:Kank1	APN	19	25430236	missense	probably benign	0.41
IGL01105:Kank1	APN	19	25424316	missense	possibly damaging	0.80
IGL01974:Kank1	APN	19	25410232	missense	possibly damaging	0.87
IGL02031:Kank1	APN	19	25410702	missense	probably benign	0.01
IGL02125:Kank1	APN	19	25410703	missense	possibly damaging	0.90
IGL02152:Kank1	APN	19	25428172	missense	possibly damaging	0.51
IGL02211:Kank1	APN	19	25430338	missense	probably damaging	1.00
IGL02440:Kank1	APN	19	25432908	missense	probably damaging	1.00
IGL02448:Kank1	APN	19	25411375	missense	probably damaging	1.00
IGL02671:Kank1	APN	19	25428095	missense	probably damaging	1.00
IGL03102:Kank1	APN	19	25425918	missense	probably damaging	1.00
IGL03259:Kank1	APN	19	25430341	missense	probably damaging	1.00
IGL02802:Kank1	UTSW	19	25411599	missense	probably damaging	1.00
R0107:Kank1	UTSW	19	25430366	unclassified	probably benign
R0190:Kank1	UTSW	19	25409283	missense	probably benign	0.00
R0330:Kank1	UTSW	19	25424313	missense	probably benign	0.00
R0368:Kank1	UTSW	19	25410603	nonsense	probably null
R0399:Kank1	UTSW	19	25411242	missense	probably benign	0.00
R0426:Kank1	UTSW	19	25411473	missense	probably damaging	1.00
R0483:Kank1	UTSW	19	25425993	unclassified	probably benign
R1394:Kank1	UTSW	19	25428164	missense	probably damaging	1.00
R1495:Kank1	UTSW	19	25410349	missense	probably damaging	0.98
R1681:Kank1	UTSW	19	25410304	missense	possibly damaging	0.89
R1698:Kank1	UTSW	19	25411317	missense	probably benign	0.11
R1830:Kank1	UTSW	19	25411032	missense	probably benign	0.00
R1866:Kank1	UTSW	19	25411449	missense	probably benign	0.04
R2138:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2139:Kank1	UTSW	19	25411753	missense	probably benign	0.00
R2420:Kank1	UTSW	19	25410457	missense	probably damaging	1.00
R4164:Kank1	UTSW	19	25411072	missense	probably benign	0.10
R4670:Kank1	UTSW	19	25410580	missense	probably benign	0.00
R4685:Kank1	UTSW	19	25410034	missense	possibly damaging	0.66
R4843:Kank1	UTSW	19	25431007	missense	probably damaging	1.00
R4981:Kank1	UTSW	19	25411395	missense	probably benign	0.19
R5189:Kank1	UTSW	19	25424181	missense	probably damaging	1.00
R5280:Kank1	UTSW	19	25411305	missense	probably benign	0.01
R5330:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5331:Kank1	UTSW	19	25411329	missense	probably damaging	1.00
R5435:Kank1	UTSW	19	25411143	missense	probably benign	0.04
R5500:Kank1	UTSW	19	25424332	missense	possibly damaging	0.46
R5894:Kank1	UTSW	19	25424200	missense	probably damaging	1.00
R6087:Kank1	UTSW	19	25409724	missense	probably benign	0.41
R6357:Kank1	UTSW	19	25411353	missense	probably benign	0.36
R6490:Kank1	UTSW	19	25410085	missense	probably damaging	1.00
R6504:Kank1	UTSW	19	25428154	missense	probably damaging	1.00
R6942:Kank1	UTSW	19	25424173	missense	possibly damaging	0.88
R7037:Kank1	UTSW	19	25430341	missense	probably damaging	1.00
R7405:Kank1	UTSW	19	25410319	nonsense	probably null
R7486:Kank1	UTSW	19	25410829	missense	probably damaging	0.99
R7602:Kank1	UTSW	19	25422161	missense	probably benign	0.01
R7701:Kank1	UTSW	19	25411765	critical splice donor site	probably null
R7765:Kank1	UTSW	19	25411205	frame shift	probably null
R7766:Kank1	UTSW	19	25411205	frame shift	probably null
R7768:Kank1	UTSW	19	25411205	frame shift	probably null
R7919:Kank1	UTSW	19	25431075	missense	probably damaging	1.00
R7974:Kank1	UTSW	19	25424220	missense	probably damaging	1.00
R7978:Kank1	UTSW	19	25411205	frame shift	probably null
R8017:Kank1	UTSW	19	25411204	frame shift	probably null
R8017:Kank1	UTSW	19	25411205	frame shift	probably null
R8020:Kank1	UTSW	19	25411205	frame shift	probably null
R8150:Kank1	UTSW	19	25410799	missense	possibly damaging	0.88
R8322:Kank1	UTSW	19	25378478	start gained	probably benign
R8374:Kank1	UTSW	19	25411641	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCGCGAGATGACTAAGCTCAAG -3'
(R):5'- TAAGGAGTGTCAGGTCGCTC -3'

Sequencing Primer
(F):5'- GCAAGAACTACAGGCTGCCG -3'
(R):5'- CCAGAAGCCTCTGTGTTGCTG -3'

Posted On

2015-02-05