Mutagenetix > Incidental Mutation

Incidental Mutation 'R2930:Abcb11'

264506

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B member 11

Synonyms

sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1

MMRRC Submission

040512-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.741) question?

Stock #

R2930 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69068626-69172960 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69087702 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1021 (V1021D)

Ref Sequence

ENSEMBL: ENSMUSP00000137017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably damaging
Transcript: ENSMUST00000102709
AA Change: V1021D

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V1021D

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102710
AA Change: V1021D

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V1021D

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126240

Predicted Effect

probably damaging
Transcript: ENSMUST00000180142
AA Change: V1021D

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V1021D

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	T	C	11: 94,252,636 (GRCm39)	N749S	probably damaging	Het
Adap1	T	C	5: 139,293,621 (GRCm39)	D30G	probably benign	Het
Camk2d	C	A	3: 126,601,880 (GRCm39)	H356Q	possibly damaging	Het
Cdc23	ACC	AC	18: 34,770,371 (GRCm39)		probably null	Het
Cfap74	G	A	4: 155,522,627 (GRCm39)	S671N	probably damaging	Het
Cul7	C	G	17: 46,962,526 (GRCm39)	D52E	probably benign	Het
Dsn1	T	C	2: 156,847,381 (GRCm39)	D19G	probably damaging	Het
Fndc3b	T	C	3: 27,524,435 (GRCm39)	T442A	probably benign	Het
Hsd3b5	C	T	3: 98,526,528 (GRCm39)	R306H	probably benign	Het
Ilf3	A	G	9: 21,310,886 (GRCm39)	K617E	possibly damaging	Het
Krt75	C	T	15: 101,476,466 (GRCm39)	R433Q	probably benign	Het
Myrfl	C	T	10: 116,653,652 (GRCm39)	V472I	probably damaging	Het
Plxna4	A	G	6: 32,142,715 (GRCm39)	L1580P	probably damaging	Het
Thop1	T	C	10: 80,909,148 (GRCm39)	S60P	probably damaging	Het
Tshz3	G	A	7: 36,471,017 (GRCm39)	R1002Q	possibly damaging	Het
Zbtb4	G	T	11: 69,667,342 (GRCm39)	G216*	probably null	Het
Zfp729b	A	G	13: 67,739,973 (GRCm39)	L764S	probably benign	Het
Zmym4	T	C	4: 126,819,316 (GRCm39)	S196G	probably benign	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69,115,025 (GRCm39)	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69,076,288 (GRCm39)	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69,126,753 (GRCm39)	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69,117,936 (GRCm39)	splice site	probably benign
IGL01885:Abcb11	APN	2	69,117,971 (GRCm39)	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69,117,956 (GRCm39)	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69,073,842 (GRCm39)	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69,154,169 (GRCm39)	splice site	probably benign
IGL02119:Abcb11	APN	2	69,158,344 (GRCm39)	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69,087,654 (GRCm39)	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69,130,269 (GRCm39)	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69,079,233 (GRCm39)	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69,095,801 (GRCm39)	nonsense	probably null
IGL02505:Abcb11	APN	2	69,076,105 (GRCm39)	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69,136,949 (GRCm39)	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69,122,293 (GRCm39)	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69,115,026 (GRCm39)	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69,122,293 (GRCm39)	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69,122,343 (GRCm39)	nonsense	probably null
IGL03181:Abcb11	APN	2	69,158,352 (GRCm39)	intron	probably benign
3-1:Abcb11	UTSW	2	69,158,337 (GRCm39)	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69,073,862 (GRCm39)	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69,115,652 (GRCm39)	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69,117,010 (GRCm39)	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69,158,355 (GRCm39)	intron	probably benign
R0437:Abcb11	UTSW	2	69,087,639 (GRCm39)	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69,108,228 (GRCm39)	splice site	probably benign
R0646:Abcb11	UTSW	2	69,115,627 (GRCm39)	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69,159,662 (GRCm39)	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69,154,262 (GRCm39)	missense	probably benign
R1061:Abcb11	UTSW	2	69,108,153 (GRCm39)	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69,087,718 (GRCm39)	splice site	probably benign
R1714:Abcb11	UTSW	2	69,136,925 (GRCm39)	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69,091,910 (GRCm39)	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69,076,267 (GRCm39)	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69,113,014 (GRCm39)	splice site	probably null
R2086:Abcb11	UTSW	2	69,089,820 (GRCm39)	splice site	probably benign
R2133:Abcb11	UTSW	2	69,154,227 (GRCm39)	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69,159,673 (GRCm39)	missense	possibly damaging	0.88
R3771:Abcb11	UTSW	2	69,159,720 (GRCm39)	splice site	probably benign
R3772:Abcb11	UTSW	2	69,159,720 (GRCm39)	splice site	probably benign
R3979:Abcb11	UTSW	2	69,154,320 (GRCm39)	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69,115,120 (GRCm39)	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69,136,949 (GRCm39)	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69,115,025 (GRCm39)	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69,115,615 (GRCm39)	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69,089,971 (GRCm39)	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69,154,306 (GRCm39)	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69,076,211 (GRCm39)	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69,076,249 (GRCm39)	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69,076,249 (GRCm39)	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69,069,540 (GRCm39)	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69,154,236 (GRCm39)	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69,104,356 (GRCm39)	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69,138,850 (GRCm39)	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69,115,639 (GRCm39)	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69,117,191 (GRCm39)	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69,076,108 (GRCm39)	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69,091,844 (GRCm39)	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69,073,811 (GRCm39)	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69,122,305 (GRCm39)	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69,154,238 (GRCm39)	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69,112,996 (GRCm39)	missense	probably benign
R6590:Abcb11	UTSW	2	69,115,062 (GRCm39)	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69,115,062 (GRCm39)	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69,117,190 (GRCm39)	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69,115,642 (GRCm39)	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69,096,019 (GRCm39)	missense	probably benign
R7223:Abcb11	UTSW	2	69,104,487 (GRCm39)	missense	probably benign
R7323:Abcb11	UTSW	2	69,117,979 (GRCm39)	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69,076,113 (GRCm39)	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69,130,211 (GRCm39)	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69,117,963 (GRCm39)	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69,134,280 (GRCm39)	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69,108,146 (GRCm39)	missense	probably benign
R7544:Abcb11	UTSW	2	69,095,830 (GRCm39)	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69,117,938 (GRCm39)	splice site	probably null
R7754:Abcb11	UTSW	2	69,117,162 (GRCm39)	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69,069,535 (GRCm39)	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69,117,022 (GRCm39)	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69,115,068 (GRCm39)	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69,154,217 (GRCm39)	small deletion	probably benign
R7897:Abcb11	UTSW	2	69,154,216 (GRCm39)	frame shift	probably null
R7937:Abcb11	UTSW	2	69,154,217 (GRCm39)	small deletion	probably benign
R8004:Abcb11	UTSW	2	69,087,554 (GRCm39)	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69,104,383 (GRCm39)	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69,069,549 (GRCm39)	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69,155,606 (GRCm39)	missense	probably benign
R8441:Abcb11	UTSW	2	69,087,574 (GRCm39)	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69,154,381 (GRCm39)	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69,104,499 (GRCm39)	missense	probably benign
R8532:Abcb11	UTSW	2	69,090,035 (GRCm39)	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69,154,190 (GRCm39)	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69,095,856 (GRCm39)	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69,087,754 (GRCm39)	intron	probably benign
R8964:Abcb11	UTSW	2	69,117,061 (GRCm39)	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69,104,494 (GRCm39)	missense
R9081:Abcb11	UTSW	2	69,122,388 (GRCm39)	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69,069,513 (GRCm39)	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69,138,809 (GRCm39)	nonsense	probably null
R9294:Abcb11	UTSW	2	69,095,840 (GRCm39)	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69,119,787 (GRCm39)	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69,076,250 (GRCm39)	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69,130,210 (GRCm39)	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69,122,325 (GRCm39)	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69,159,613 (GRCm39)	critical splice donor site	probably null
Z1177:Abcb11	UTSW	2	69,136,873 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGTACACATGCACAAGTGTG -3'
(R):5'- AGGGTTTGAAGGTCTGAACC -3'

Sequencing Primer
(F):5'- GTGAGCACACACACACAAAC -3'
(R):5'- GGTCTGAACCCTATCTTGCTTG -3'

Posted On

2015-02-05