Incidental Mutation 'R2930:Adap1'
ID264514
Institutional Source Beutler Lab
Gene Symbol Adap1
Ensembl Gene ENSMUSG00000056413
Gene NameArfGAP with dual PH domains 1
Synonyms4930431P11Rik, Centa1, centaurin alpha 1
MMRRC Submission 040512-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2930 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139271876-139325622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139307866 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 30 (D30G)
Ref Sequence ENSEMBL: ENSMUSP00000106489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110865]
Predicted Effect probably benign
Transcript: ENSMUST00000110865
AA Change: D30G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106489
Gene: ENSMUSG00000056413
AA Change: D30G

DomainStartEndE-ValueType
ArfGap 7 126 2.45e-60 SMART
PH 130 232 1.02e-5 SMART
PH 253 358 9.48e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196271
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,257,358 V1021D probably damaging Het
Abcc3 T C 11: 94,361,810 N749S probably damaging Het
Camk2d C A 3: 126,808,231 H356Q possibly damaging Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Cfap74 G A 4: 155,438,170 S671N probably damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Dsn1 T C 2: 157,005,461 D19G probably damaging Het
Fndc3b T C 3: 27,470,286 T442A probably benign Het
Hsd3b5 C T 3: 98,619,212 R306H probably benign Het
Ilf3 A G 9: 21,399,590 K617E possibly damaging Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Myrfl C T 10: 116,817,747 V472I probably damaging Het
Plxna4 A G 6: 32,165,780 L1580P probably damaging Het
Thop1 T C 10: 81,073,314 S60P probably damaging Het
Tshz3 G A 7: 36,771,592 R1002Q possibly damaging Het
Zbtb4 G T 11: 69,776,516 G216* probably null Het
Zfp729b A G 13: 67,591,854 L764S probably benign Het
Zmym4 T C 4: 126,925,523 S196G probably benign Het
Other mutations in Adap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02601:Adap1 APN 5 139307786 missense probably damaging 1.00
R0012:Adap1 UTSW 5 139307734 splice site probably benign
R0012:Adap1 UTSW 5 139307734 splice site probably benign
R0137:Adap1 UTSW 5 139293221 splice site probably benign
R1959:Adap1 UTSW 5 139273341 missense probably benign 0.01
R2913:Adap1 UTSW 5 139274821 splice site probably null
R6154:Adap1 UTSW 5 139307776 missense possibly damaging 0.68
R6291:Adap1 UTSW 5 139273491 missense probably benign 0.01
R6735:Adap1 UTSW 5 139293145 missense probably damaging 1.00
R7537:Adap1 UTSW 5 139293173 missense possibly damaging 0.81
R7559:Adap1 UTSW 5 139279540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGAGCTAGGGTCATCC -3'
(R):5'- AGATTCTTAACTGGTGCAGGAT -3'

Sequencing Primer
(F):5'- ATATGGACACAGGGTACC -3'
(R):5'- TGGTAGAGCTCCTGCCTAGAATC -3'
Posted On2015-02-05