Incidental Mutation 'R2931:Zscan12'
ID264541
Institutional Source Beutler Lab
Gene Symbol Zscan12
Ensembl Gene ENSMUSG00000036721
Gene Namezinc finger and SCAN domain containing 12
SynonymsZfp96
MMRRC Submission 040513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2931 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21362820-21372289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21364017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 123 (D123G)
Ref Sequence ENSEMBL: ENSMUSP00000153548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053293] [ENSMUST00000099720] [ENSMUST00000225545]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053293
AA Change: D123G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058904
Gene: ENSMUSG00000036721
AA Change: D123G

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000099720
AA Change: D123G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097308
Gene: ENSMUSG00000036721
AA Change: D123G

DomainStartEndE-ValueType
SCAN 42 154 2.52e-74 SMART
ZnF_C2H2 269 291 5.5e-3 SMART
ZnF_C2H2 297 319 1.72e-4 SMART
ZnF_C2H2 325 347 1.22e-4 SMART
ZnF_C2H2 353 375 5.5e-3 SMART
ZnF_C2H2 381 403 1.95e-3 SMART
ZnF_C2H2 409 431 1.45e-2 SMART
ZnF_C2H2 455 477 2.43e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000225545
AA Change: D123G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Asb2 T C 12: 103,334,887 D151G probably damaging Het
Cyp2c69 G A 19: 39,849,483 T385I probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dido1 T C 2: 180,661,653 E1486G probably damaging Het
Kdm5d T C Y: 942,992 F1492L probably benign Het
Map2k4 A T 11: 65,756,337 N59K probably damaging Het
Myo18b A G 5: 112,693,127 S2267P probably benign Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Otogl A T 10: 107,820,004 M1080K possibly damaging Het
Pirb A T 7: 3,717,206 H389Q probably benign Het
Sptan1 A G 2: 30,018,488 T1739A probably benign Het
Strip1 T A 3: 107,625,659 probably null Het
Trappc11 A T 8: 47,503,942 D816E probably damaging Het
Other mutations in Zscan12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02864:Zscan12 APN 13 21368560 missense probably benign 0.02
PIT4480001:Zscan12 UTSW 13 21368574 missense possibly damaging 0.72
R0122:Zscan12 UTSW 13 21368969 missense probably damaging 1.00
R1605:Zscan12 UTSW 13 21366643 missense probably benign 0.00
R1639:Zscan12 UTSW 13 21368986 missense probably damaging 0.99
R2182:Zscan12 UTSW 13 21368791 missense probably benign 0.33
R3930:Zscan12 UTSW 13 21368630 missense probably benign 0.18
R4368:Zscan12 UTSW 13 21369383 missense probably benign 0.00
R4461:Zscan12 UTSW 13 21366619 missense possibly damaging 0.83
R4545:Zscan12 UTSW 13 21366705 missense possibly damaging 0.83
R5353:Zscan12 UTSW 13 21364008 missense possibly damaging 0.51
R6580:Zscan12 UTSW 13 21369158 missense probably damaging 0.99
R6734:Zscan12 UTSW 13 21368796 nonsense probably null
R7462:Zscan12 UTSW 13 21369287 missense possibly damaging 0.94
R7505:Zscan12 UTSW 13 21368586 missense possibly damaging 0.72
R7822:Zscan12 UTSW 13 21369204 missense probably damaging 0.99
R8028:Zscan12 UTSW 13 21368852 missense probably benign 0.01
R8056:Zscan12 UTSW 13 21369322 missense probably benign 0.29
R8161:Zscan12 UTSW 13 21363727 missense probably benign 0.01
R8784:Zscan12 UTSW 13 21363821 missense possibly damaging 0.82
R8794:Zscan12 UTSW 13 21363677 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACCAGGAAACTTCTGGACCC -3'
(R):5'- CCTTGTGTGTCTGAACTAAGCATC -3'

Sequencing Primer
(F):5'- CTTCTGGACCCCGGGAG -3'
(R):5'- GAGTGGACGTACATACCTGTAATCTC -3'
Posted On2015-02-05