Incidental Mutation 'R2939:Nmnat2'
ID264547
Institutional Source Beutler Lab
Gene Symbol Nmnat2
Ensembl Gene ENSMUSG00000042751
Gene Namenicotinamide nucleotide adenylyltransferase 2
SynonymsPNAT1, D030041I09Rik
MMRRC Submission 040516-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2939 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152954993-153119261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153074728 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 53 (S53Y)
Ref Sequence ENSEMBL: ENSMUSP00000140497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043313] [ENSMUST00000186368] [ENSMUST00000186621]
Predicted Effect probably damaging
Transcript: ENSMUST00000043313
AA Change: S77Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041110
Gene: ENSMUSG00000042751
AA Change: S77Y

DomainStartEndE-ValueType
Pfam:CTP_transf_like 12 276 2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185241
Predicted Effect probably damaging
Transcript: ENSMUST00000186368
AA Change: S77Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140585
Gene: ENSMUSG00000042751
AA Change: S77Y

DomainStartEndE-ValueType
Pfam:CTP_transf_2 12 275 2e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186621
AA Change: S53Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140497
Gene: ENSMUSG00000042751
AA Change: S53Y

DomainStartEndE-ValueType
Pfam:CTP_transf_2 1 184 9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190117
Meta Mutation Damage Score 0.7669 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family, members of which catalyze an essential step in NAD (NADP) biosynthetic pathway. Unlike the other human family member, which is localized to the nucleus, and is ubiquitously expressed; this enzyme is cytoplasmic, and is predominantly expressed in the brain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap or transposon inserted allele exhibit perinatal lethality, distended bladders, atelectasis and loss of axon integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,946 K760E probably benign Het
1810043G02Rik A G 10: 77,981,673 N78S probably benign Het
Actl11 T C 9: 107,931,210 Y911H possibly damaging Het
Arhgef26 A C 3: 62,380,910 K467T possibly damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Atm T C 9: 53,494,711 Y1219C probably damaging Het
Azin2 C T 4: 128,934,604 C270Y probably benign Het
Brsk1 A T 7: 4,708,140 I545F possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cfap69 G A 5: 5,644,432 A143V probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Col5a3 T C 9: 20,795,658 K714R unknown Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dagla A C 19: 10,256,364 F382C probably damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif5 T C 12: 111,540,279 C102R probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam71a T C 1: 191,163,906 D180G possibly damaging Het
Fhdc1 A G 3: 84,457,270 V223A possibly damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Gpatch8 A G 11: 102,508,184 V74A unknown Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Ksr1 A G 11: 79,045,181 probably null Het
Lama5 A C 2: 180,198,954 Y584D probably damaging Het
Lgi4 C T 7: 31,067,828 R427* probably null Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcsk7 C T 9: 45,916,024 A363V probably damaging Het
Pdrg1 C T 2: 153,012,435 G62R probably damaging Het
Pdzd7 A G 19: 45,045,423 I74T possibly damaging Het
Plcb4 T C 2: 135,939,203 probably benign Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Rph3a A G 5: 120,980,149 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc1a6 G T 10: 78,814,614 *562L probably null Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Slc45a3 A G 1: 131,977,899 E206G probably damaging Het
Slc9a3r1 C T 11: 115,180,444 R335C probably damaging Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Smpd3 A G 8: 106,257,407 V560A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Suco A G 1: 161,848,651 I386T probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmprss11e G A 5: 86,721,407 R96W probably damaging Het
Trim63 T C 4: 134,322,997 probably benign Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Unc79 C T 12: 102,991,425 T33I probably damaging Het
Usp47 G A 7: 112,082,536 S518N probably damaging Het
Vmn2r22 T A 6: 123,637,635 D332V probably damaging Het
Vmn2r55 A G 7: 12,651,905 L716P probably damaging Het
Zfp558 T C 9: 18,456,628 N288S possibly damaging Het
Other mutations in Nmnat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Nmnat2 APN 1 153094117 splice site probably null
IGL01447:Nmnat2 APN 1 153112443 missense possibly damaging 0.50
IGL01686:Nmnat2 APN 1 153076997 splice site probably benign
IGL01916:Nmnat2 APN 1 153094046 missense probably damaging 0.99
R0309:Nmnat2 UTSW 1 153077001 splice site probably benign
R1245:Nmnat2 UTSW 1 153112203 missense probably benign 0.12
R1475:Nmnat2 UTSW 1 153074695 missense probably damaging 1.00
R1780:Nmnat2 UTSW 1 153112440 nonsense probably null
R2860:Nmnat2 UTSW 1 153112425 missense probably benign
R2861:Nmnat2 UTSW 1 153112425 missense probably benign
R2862:Nmnat2 UTSW 1 153112425 missense probably benign
R5590:Nmnat2 UTSW 1 153094061 missense probably damaging 1.00
R6056:Nmnat2 UTSW 1 153074734 nonsense probably null
R6267:Nmnat2 UTSW 1 153076971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCTCACCATCAGACATAGC -3'
(R):5'- TCTAAGAGCCACACCAGGAG -3'

Sequencing Primer
(F):5'- TAGCCCCGCACTTCGTAACG -3'
(R):5'- GCTAACTCTTTAATTTTGTGAGCCTG -3'
Posted On2015-02-05