Incidental Mutation 'R2939:Cfap69'
ID264561
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission 040516-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2939 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5644432 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 143 (A143V)
Ref Sequence ENSEMBL: ENSMUSP00000143393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000196165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054865
AA Change: A143V

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: A143V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061008
AA Change: A143V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473
AA Change: A143V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132510
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135252
AA Change: A143V

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473
AA Change: A143V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196165
AA Change: A143V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: A143V

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198121
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,946 K760E probably benign Het
1810043G02Rik A G 10: 77,981,673 N78S probably benign Het
Actl11 T C 9: 107,931,210 Y911H possibly damaging Het
Arhgef26 A C 3: 62,380,910 K467T possibly damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Atm T C 9: 53,494,711 Y1219C probably damaging Het
Azin2 C T 4: 128,934,604 C270Y probably benign Het
Brsk1 A T 7: 4,708,140 I545F possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Col5a3 T C 9: 20,795,658 K714R unknown Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dagla A C 19: 10,256,364 F382C probably damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif5 T C 12: 111,540,279 C102R probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam71a T C 1: 191,163,906 D180G possibly damaging Het
Fhdc1 A G 3: 84,457,270 V223A possibly damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Gpatch8 A G 11: 102,508,184 V74A unknown Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Ksr1 A G 11: 79,045,181 probably null Het
Lama5 A C 2: 180,198,954 Y584D probably damaging Het
Lgi4 C T 7: 31,067,828 R427* probably null Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nmnat2 C A 1: 153,074,728 S53Y probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcsk7 C T 9: 45,916,024 A363V probably damaging Het
Pdrg1 C T 2: 153,012,435 G62R probably damaging Het
Pdzd7 A G 19: 45,045,423 I74T possibly damaging Het
Plcb4 T C 2: 135,939,203 probably benign Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Rph3a A G 5: 120,980,149 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc1a6 G T 10: 78,814,614 *562L probably null Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Slc45a3 A G 1: 131,977,899 E206G probably damaging Het
Slc9a3r1 C T 11: 115,180,444 R335C probably damaging Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Smpd3 A G 8: 106,257,407 V560A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Suco A G 1: 161,848,651 I386T probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmprss11e G A 5: 86,721,407 R96W probably damaging Het
Trim63 T C 4: 134,322,997 probably benign Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Unc79 C T 12: 102,991,425 T33I probably damaging Het
Usp47 G A 7: 112,082,536 S518N probably damaging Het
Vmn2r22 T A 6: 123,637,635 D332V probably damaging Het
Vmn2r55 A G 7: 12,651,905 L716P probably damaging Het
Zfp558 T C 9: 18,456,628 N288S possibly damaging Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
R7455:Cfap69 UTSW 5 5625873 missense possibly damaging 0.92
R7544:Cfap69 UTSW 5 5595936 missense not run
R7547:Cfap69 UTSW 5 5604290 missense possibly damaging 0.88
R7787:Cfap69 UTSW 5 5589260 missense probably damaging 1.00
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Z1177:Cfap69 UTSW 5 5586384 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTAAAAGAAGACTGCAGATACTTGG -3'
(R):5'- ATATGATAGGCTAGGACAGAATATCCC -3'

Sequencing Primer
(F):5'- GAGTTGGACATGAGATTCCATCCC -3'
(R):5'- GGCTAGGACAGAATATCCCTTATTC -3'
Posted On2015-02-05