Incidental Mutation 'R2939:Actl11'
ID264591
Institutional Source Beutler Lab
Gene Symbol Actl11
Ensembl Gene ENSMUSG00000066368
Gene Nameactin-like 11
Synonyms
MMRRC Submission 040516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2939 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107928469-107932461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107931210 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 911 (Y911H)
Ref Sequence ENSEMBL: ENSMUSP00000082150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035700] [ENSMUST00000085073] [ENSMUST00000193533]
Predicted Effect probably benign
Transcript: ENSMUST00000035700
SMART Domains Protein: ENSMUSP00000040430
Gene: ENSMUSG00000032936

DomainStartEndE-ValueType
S_TKc 24 286 4.21e-81 SMART
low complexity region 332 385 N/A INTRINSIC
internal_repeat_1 392 425 3.43e-15 PROSPERO
internal_repeat_1 416 449 3.43e-15 PROSPERO
low complexity region 461 478 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085073
AA Change: Y911H

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082150
Gene: ENSMUSG00000066368
AA Change: Y911H

DomainStartEndE-ValueType
low complexity region 223 239 N/A INTRINSIC
low complexity region 301 309 N/A INTRINSIC
low complexity region 374 391 N/A INTRINSIC
low complexity region 492 507 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
ACTIN 858 1207 4.26e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192318
Predicted Effect probably benign
Transcript: ENSMUST00000193533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193668
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,946 K760E probably benign Het
1810043G02Rik A G 10: 77,981,673 N78S probably benign Het
Arhgef26 A C 3: 62,380,910 K467T possibly damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Atm T C 9: 53,494,711 Y1219C probably damaging Het
Azin2 C T 4: 128,934,604 C270Y probably benign Het
Brsk1 A T 7: 4,708,140 I545F possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cfap69 G A 5: 5,644,432 A143V probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Col5a3 T C 9: 20,795,658 K714R unknown Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dagla A C 19: 10,256,364 F382C probably damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif5 T C 12: 111,540,279 C102R probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam71a T C 1: 191,163,906 D180G possibly damaging Het
Fhdc1 A G 3: 84,457,270 V223A possibly damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Gpatch8 A G 11: 102,508,184 V74A unknown Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Ksr1 A G 11: 79,045,181 probably null Het
Lama5 A C 2: 180,198,954 Y584D probably damaging Het
Lgi4 C T 7: 31,067,828 R427* probably null Het
Lrriq1 T A 10: 103,144,889 S1462C probably damaging Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nmnat2 C A 1: 153,074,728 S53Y probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcsk7 C T 9: 45,916,024 A363V probably damaging Het
Pdrg1 C T 2: 153,012,435 G62R probably damaging Het
Pdzd7 A G 19: 45,045,423 I74T possibly damaging Het
Plcb4 T C 2: 135,939,203 probably benign Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Rph3a A G 5: 120,980,149 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc1a6 G T 10: 78,814,614 *562L probably null Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Slc45a3 A G 1: 131,977,899 E206G probably damaging Het
Slc9a3r1 C T 11: 115,180,444 R335C probably damaging Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Smpd3 A G 8: 106,257,407 V560A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Suco A G 1: 161,848,651 I386T probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmprss11e G A 5: 86,721,407 R96W probably damaging Het
Trim63 T C 4: 134,322,997 probably benign Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Unc79 C T 12: 102,991,425 T33I probably damaging Het
Usp47 G A 7: 112,082,536 S518N probably damaging Het
Vmn2r22 T A 6: 123,637,635 D332V probably damaging Het
Vmn2r55 A G 7: 12,651,905 L716P probably damaging Het
Zfp558 T C 9: 18,456,628 N288S possibly damaging Het
Other mutations in Actl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Actl11 APN 9 107928982 missense possibly damaging 0.49
IGL01396:Actl11 APN 9 107928765 missense possibly damaging 0.71
IGL01622:Actl11 APN 9 107928576 missense probably benign 0.03
IGL01623:Actl11 APN 9 107928576 missense probably benign 0.03
IGL01660:Actl11 APN 9 107929048 missense probably benign
IGL01912:Actl11 APN 9 107929645 missense probably damaging 0.98
IGL02002:Actl11 APN 9 107929330 missense probably benign 0.08
IGL02266:Actl11 APN 9 107931183 missense possibly damaging 0.76
IGL02535:Actl11 APN 9 107929937 missense possibly damaging 0.71
IGL02692:Actl11 APN 9 107929308 missense probably benign 0.06
IGL02744:Actl11 APN 9 107929862 missense probably benign 0.04
IGL02864:Actl11 APN 9 107928987 missense probably benign 0.25
IGL03037:Actl11 APN 9 107930095 missense probably damaging 0.99
IGL03085:Actl11 APN 9 107929550 missense probably damaging 0.98
R0167:Actl11 UTSW 9 107929770 missense probably damaging 1.00
R0304:Actl11 UTSW 9 107929768 missense probably damaging 1.00
R0959:Actl11 UTSW 9 107931235 missense probably damaging 1.00
R1499:Actl11 UTSW 9 107931483 missense probably damaging 1.00
R1616:Actl11 UTSW 9 107931936 missense probably benign 0.39
R1694:Actl11 UTSW 9 107930008 missense probably damaging 1.00
R1927:Actl11 UTSW 9 107929537 missense possibly damaging 0.88
R2081:Actl11 UTSW 9 107930197 missense probably benign
R3427:Actl11 UTSW 9 107929770 missense probably damaging 1.00
R4812:Actl11 UTSW 9 107931130 missense probably damaging 0.99
R4843:Actl11 UTSW 9 107929492 missense possibly damaging 0.61
R4972:Actl11 UTSW 9 107929956 missense probably benign 0.07
R4989:Actl11 UTSW 9 107931416 missense probably damaging 1.00
R4996:Actl11 UTSW 9 107931735 missense possibly damaging 0.77
R5320:Actl11 UTSW 9 107931004 missense possibly damaging 0.73
R5546:Actl11 UTSW 9 107929633 missense probably benign 0.00
R5810:Actl11 UTSW 9 107929221 missense probably benign 0.23
R6302:Actl11 UTSW 9 107929573 missense probably benign 0.12
R6412:Actl11 UTSW 9 107929917 missense probably benign 0.01
R6835:Actl11 UTSW 9 107930562 missense probably benign
R6891:Actl11 UTSW 9 107929147 missense probably benign 0.03
R7195:Actl11 UTSW 9 107928870 nonsense probably null
R7212:Actl11 UTSW 9 107928657 missense probably damaging 0.99
X0024:Actl11 UTSW 9 107930505 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGCAATCAGCTGTGCTCTG -3'
(R):5'- TAGCTGGCACATGGAAACGC -3'

Sequencing Primer
(F):5'- AATCAGCTGTGCTCTGTAACCG -3'
(R):5'- CGCTCAAAGAGTATTTCGGC -3'
Posted On2015-02-05