Incidental Mutation 'R2939:Lrriq1'
ID264596
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Nameleucine-rich repeats and IQ motif containing 1
SynonymsLOC380658, 4930503E15Rik, Gm1557
MMRRC Submission 040516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2939 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location103046031-103236322 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103144889 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 1462 (S1462C)
Ref Sequence ENSEMBL: ENSMUSP00000131419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166240]
Predicted Effect probably damaging
Transcript: ENSMUST00000166240
AA Change: S1462C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: S1462C

DomainStartEndE-ValueType
coiled coil region 11 31 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
coiled coil region 183 286 N/A INTRINSIC
IQ 290 312 9.78e1 SMART
coiled coil region 314 390 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
LRR 873 894 2.14e1 SMART
LRR 895 917 4.45e1 SMART
LRR 984 1005 2.03e2 SMART
LRR 1029 1052 3.65e0 SMART
low complexity region 1244 1258 N/A INTRINSIC
IQ 1279 1301 5.61e1 SMART
IQ 1339 1361 6.7e-3 SMART
low complexity region 1369 1394 N/A INTRINSIC
low complexity region 1502 1518 N/A INTRINSIC
low complexity region 1528 1543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217834
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,972,946 K760E probably benign Het
1810043G02Rik A G 10: 77,981,673 N78S probably benign Het
Actl11 T C 9: 107,931,210 Y911H possibly damaging Het
Arhgef26 A C 3: 62,380,910 K467T possibly damaging Het
Armcx6 A T X: 134,749,876 W69R probably damaging Het
Asl T C 5: 130,013,404 Y277C probably damaging Het
Atm T C 9: 53,494,711 Y1219C probably damaging Het
Azin2 C T 4: 128,934,604 C270Y probably benign Het
Brsk1 A T 7: 4,708,140 I545F possibly damaging Het
Carm1 C A 9: 21,579,396 probably null Het
Cfap69 G A 5: 5,644,432 A143V probably damaging Het
Cldn14 T C 16: 93,919,304 K218R probably damaging Het
Col5a3 T C 9: 20,795,658 K714R unknown Het
Crybg2 A G 4: 134,082,434 H1517R possibly damaging Het
Dagla A C 19: 10,256,364 F382C probably damaging Het
Dixdc1 G A 9: 50,710,959 A25V probably damaging Het
Dock6 A G 9: 21,839,200 F473L possibly damaging Het
Eif5 T C 12: 111,540,279 C102R probably damaging Het
Faiml A G 9: 99,232,474 C121R probably damaging Het
Fam71a T C 1: 191,163,906 D180G possibly damaging Het
Fhdc1 A G 3: 84,457,270 V223A possibly damaging Het
Gm13101 A G 4: 143,966,677 V77A probably benign Het
Gpatch8 A G 11: 102,508,184 V74A unknown Het
Haghl A G 17: 25,785,086 V8A possibly damaging Het
Ksr1 A G 11: 79,045,181 probably null Het
Lama5 A C 2: 180,198,954 Y584D probably damaging Het
Lgi4 C T 7: 31,067,828 R427* probably null Het
Map3k4 C T 17: 12,261,270 E682K probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nmnat2 C A 1: 153,074,728 S53Y probably damaging Het
Olfr870 C A 9: 20,170,765 G269W probably benign Het
Olfr954 G A 9: 39,461,930 M166I probably benign Het
Pcsk7 C T 9: 45,916,024 A363V probably damaging Het
Pdrg1 C T 2: 153,012,435 G62R probably damaging Het
Pdzd7 A G 19: 45,045,423 I74T possibly damaging Het
Plcb4 T C 2: 135,939,203 probably benign Het
Rnf25 A G 1: 74,595,888 V135A possibly damaging Het
Rph3a A G 5: 120,980,149 probably benign Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Het
Senp6 G A 9: 80,143,842 A1134T probably benign Het
Slc1a6 G T 10: 78,814,614 *562L probably null Het
Slc26a6 G A 9: 108,857,037 V206I probably benign Het
Slc45a3 A G 1: 131,977,899 E206G probably damaging Het
Slc9a3r1 C T 11: 115,180,444 R335C probably damaging Het
Smc1a T A X: 152,033,699 Y516N probably damaging Het
Smpd3 A G 8: 106,257,407 V560A probably benign Het
Ssc4d T C 5: 135,965,724 T51A possibly damaging Het
Suco A G 1: 161,848,651 I386T probably damaging Het
Tecta A T 9: 42,377,994 M425K possibly damaging Het
Tmprss11e G A 5: 86,721,407 R96W probably damaging Het
Trim63 T C 4: 134,322,997 probably benign Het
Trpv1 A G 11: 73,254,849 K403R probably damaging Het
Ttc39d A G 17: 80,217,553 Y547C probably damaging Het
Unc79 C T 12: 102,991,425 T33I probably damaging Het
Usp47 G A 7: 112,082,536 S518N probably damaging Het
Vmn2r22 T A 6: 123,637,635 D332V probably damaging Het
Vmn2r55 A G 7: 12,651,905 L716P probably damaging Het
Zfp558 T C 9: 18,456,628 N288S possibly damaging Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103214946 missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103170547 missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103234068 missense possibly damaging 0.57
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGAATGCCCCAAAATATCTACCTC -3'
(R):5'- AATAAGAGTCCCAGGGCCAC -3'

Sequencing Primer
(F):5'- ACCTCCTCGGATATCCAGTAG -3'
(R):5'- TCAGCAAAAGGATTGAAATATGCCC -3'
Posted On2015-02-05