Incidental Mutation 'R2944:Tmprss11a'
ID264618
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Nametransmembrane protease, serine 11a
SynonymsLOC194597
MMRRC Submission 040518-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2944 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86410410-86468990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86428652 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 113 (R113S)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
Predicted Effect probably benign
Transcript: ENSMUST00000101073
AA Change: R113S

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: R113S

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,975,507 M179V probably null Het
AF366264 A T 8: 13,837,212 L293Q probably damaging Het
Alms1 C T 6: 85,628,391 T2341I probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Cdcp2 A C 4: 107,102,558 S57R possibly damaging Het
Cmya5 T A 13: 93,092,842 K1913* probably null Het
Coro1c C G 5: 113,850,800 G161R probably damaging Het
Csnk1a1 T C 18: 61,578,689 M258T probably benign Het
Dnah3 A G 7: 119,951,110 C3318R probably damaging Het
Fyco1 A T 9: 123,826,648 M1015K probably benign Het
Hfm1 A G 5: 106,872,330 S290P probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lce1i G A 3: 92,777,756 P38S unknown Het
Nup210l T A 3: 90,181,545 S1156T probably damaging Het
Olfr955 A T 9: 39,469,938 S263T possibly damaging Het
Sec14l5 T A 16: 5,180,833 I579N probably benign Het
Sh3tc1 C A 5: 35,714,160 V107L probably damaging Het
Trmt10b A G 4: 45,300,445 M1V probably null Het
Ush1c T C 7: 46,200,982 E791G probably damaging Het
Uspl1 T C 5: 149,201,796 L328P probably damaging Het
Utrn G T 10: 12,643,419 T2263K probably damaging Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86422519 missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86422648 missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86414527 missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86411925 critical splice acceptor site probably null
R1273:Tmprss11a UTSW 5 86414588 missense probably benign 0.10
R1704:Tmprss11a UTSW 5 86428702 missense probably benign 0.25
R1756:Tmprss11a UTSW 5 86420179 missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86420032 missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86431843 missense probably benign 0.23
R3881:Tmprss11a UTSW 5 86445805 missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86428578 missense probably benign 0.00
R4515:Tmprss11a UTSW 5 86420196 missense probably damaging 1.00
R4530:Tmprss11a UTSW 5 86428681 missense possibly damaging 0.79
R4543:Tmprss11a UTSW 5 86411809 nonsense probably null
R4881:Tmprss11a UTSW 5 86422573 missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86420000 critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86420079 missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86411806 missense probably damaging 0.99
R5313:Tmprss11a UTSW 5 86411815 missense probably damaging 1.00
R6516:Tmprss11a UTSW 5 86420128 missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86428635 missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86428570 missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86444134 missense possibly damaging 0.50
R7962:Tmprss11a UTSW 5 86420020 missense probably damaging 1.00
X0057:Tmprss11a UTSW 5 86445808 missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86414578 missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86428631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGTCAGACATGCTTTCGTCAG -3'
(R):5'- CTTGACTTGCTCAGCACCTG -3'

Sequencing Primer
(F):5'- TCAAATGCCTCATCTTTAGGTTG -3'
(R):5'- CACCTGAGGCAGATCTGGAAATC -3'
Posted On2015-02-05