Incidental Mutation 'R2944:AF366264'
ID 264627
Institutional Source Beutler Lab
Gene Symbol AF366264
Ensembl Gene ENSMUSG00000057116
Gene Name cDNA sequence AF366264
Synonyms
MMRRC Submission 040518-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock # R2944 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 13835233-13838389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13837212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 293 (L293Q)
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
AlphaFold G3X9P9
Predicted Effect probably damaging
Transcript: ENSMUST00000071308
AA Change: L293Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116
AA Change: L293Q

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,975,507 M179V probably null Het
Alms1 C T 6: 85,628,391 T2341I probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Cdcp2 A C 4: 107,102,558 S57R possibly damaging Het
Cmya5 T A 13: 93,092,842 K1913* probably null Het
Coro1c C G 5: 113,850,800 G161R probably damaging Het
Csnk1a1 T C 18: 61,578,689 M258T probably benign Het
Dnah3 A G 7: 119,951,110 C3318R probably damaging Het
Fyco1 A T 9: 123,826,648 M1015K probably benign Het
Hfm1 A G 5: 106,872,330 S290P probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lce1i G A 3: 92,777,756 P38S unknown Het
Nup210l T A 3: 90,181,545 S1156T probably damaging Het
Olfr955 A T 9: 39,469,938 S263T possibly damaging Het
Sec14l5 T A 16: 5,180,833 I579N probably benign Het
Sh3tc1 C A 5: 35,714,160 V107L probably damaging Het
Tmprss11a T G 5: 86,428,652 R113S probably benign Het
Trmt10b A G 4: 45,300,445 M1V probably null Het
Ush1c T C 7: 46,200,982 E791G probably damaging Het
Uspl1 T C 5: 149,201,796 L328P probably damaging Het
Utrn G T 10: 12,643,419 T2263K probably damaging Het
Other mutations in AF366264
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:AF366264 APN 8 13837704 missense probably benign 0.03
IGL02647:AF366264 APN 8 13836979 missense probably damaging 0.96
IGL03118:AF366264 APN 8 13838096 utr 5 prime probably benign
FR4342:AF366264 UTSW 8 13837613 missense probably benign 0.00
R0636:AF366264 UTSW 8 13837870 missense probably benign 0.00
R1796:AF366264 UTSW 8 13836816 nonsense probably null
R1913:AF366264 UTSW 8 13837143 missense probably benign 0.16
R2353:AF366264 UTSW 8 13836951 missense probably damaging 1.00
R3714:AF366264 UTSW 8 13836736 missense probably benign 0.04
R4222:AF366264 UTSW 8 13838061 missense probably benign
R4628:AF366264 UTSW 8 13836625 missense probably damaging 1.00
R4801:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4802:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4836:AF366264 UTSW 8 13838007 missense probably benign
R5143:AF366264 UTSW 8 13836844 missense possibly damaging 0.87
R5637:AF366264 UTSW 8 13837713 missense possibly damaging 0.46
R5930:AF366264 UTSW 8 13837263 missense probably benign 0.06
R6540:AF366264 UTSW 8 13837573 missense probably benign 0.07
R6556:AF366264 UTSW 8 13837690 nonsense probably null
R6724:AF366264 UTSW 8 13837083 missense probably damaging 1.00
R7131:AF366264 UTSW 8 13836982 missense probably damaging 0.98
R7148:AF366264 UTSW 8 13837996 missense probably benign 0.01
R7660:AF366264 UTSW 8 13837995 missense probably benign 0.06
R8198:AF366264 UTSW 8 13837056 missense probably benign 0.11
R8483:AF366264 UTSW 8 13838229 start gained probably benign
R9090:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
R9271:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
X0020:AF366264 UTSW 8 13836847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCACTATGCTTTAGCTTGGG -3'
(R):5'- GGAGCCTGATTTACCGGAAAC -3'

Sequencing Primer
(F):5'- CACTATGCTTTAGCTTGGGGTAAAAG -3'
(R):5'- TTTACCGGAAACATGGGCTC -3'
Posted On 2015-02-05