Incidental Mutation 'R2944:Olfr955'
ID264628
Institutional Source Beutler Lab
Gene Symbol Olfr955
Ensembl Gene ENSMUSG00000063176
Gene Nameolfactory receptor 955
SynonymsMOR171-50, GA_x6K02T2PVTD-33167297-33166353, MOR171-34
MMRRC Submission 040518-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2944 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39465801-39471944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39469938 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 263 (S263T)
Ref Sequence ENSEMBL: ENSMUSP00000151246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073946] [ENSMUST00000220176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073946
AA Change: S263T

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073602
Gene: ENSMUSG00000063176
AA Change: S263T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219910
Predicted Effect possibly damaging
Transcript: ENSMUST00000220176
AA Change: S263T

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 133,975,507 M179V probably null Het
AF366264 A T 8: 13,837,212 L293Q probably damaging Het
Alms1 C T 6: 85,628,391 T2341I probably damaging Het
Bpnt1 A G 1: 185,352,209 T168A probably damaging Het
Cdcp2 A C 4: 107,102,558 S57R possibly damaging Het
Cmya5 T A 13: 93,092,842 K1913* probably null Het
Coro1c C G 5: 113,850,800 G161R probably damaging Het
Csnk1a1 T C 18: 61,578,689 M258T probably benign Het
Dnah3 A G 7: 119,951,110 C3318R probably damaging Het
Fyco1 A T 9: 123,826,648 M1015K probably benign Het
Hfm1 A G 5: 106,872,330 S290P probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Lce1i G A 3: 92,777,756 P38S unknown Het
Nup210l T A 3: 90,181,545 S1156T probably damaging Het
Sec14l5 T A 16: 5,180,833 I579N probably benign Het
Sh3tc1 C A 5: 35,714,160 V107L probably damaging Het
Tmprss11a T G 5: 86,428,652 R113S probably benign Het
Trmt10b A G 4: 45,300,445 M1V probably null Het
Ush1c T C 7: 46,200,982 E791G probably damaging Het
Uspl1 T C 5: 149,201,796 L328P probably damaging Het
Utrn G T 10: 12,643,419 T2263K probably damaging Het
Other mutations in Olfr955
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Olfr955 APN 9 39470243 missense probably benign 0.00
IGL02550:Olfr955 APN 9 39470546 missense probably benign 0.42
IGL02743:Olfr955 APN 9 39470246 missense probably benign 0.10
R0029:Olfr955 UTSW 9 39470660 missense probably benign 0.06
R0329:Olfr955 UTSW 9 39470556 missense possibly damaging 0.52
R0610:Olfr955 UTSW 9 39469823 missense probably damaging 0.98
R1420:Olfr955 UTSW 9 39469993 missense probably damaging 1.00
R1636:Olfr955 UTSW 9 39469919 missense probably benign 0.03
R1937:Olfr955 UTSW 9 39470037 missense possibly damaging 0.63
R2655:Olfr955 UTSW 9 39470628 missense probably benign
R3788:Olfr955 UTSW 9 39470069 missense probably benign 0.03
R4829:Olfr955 UTSW 9 39470367 missense probably damaging 0.99
R5625:Olfr955 UTSW 9 39469803 missense probably benign
R6168:Olfr955 UTSW 9 39470657 missense probably damaging 1.00
R6383:Olfr955 UTSW 9 39470630 missense probably damaging 1.00
R6418:Olfr955 UTSW 9 39469816 missense probably benign 0.07
R6645:Olfr955 UTSW 9 39470266 missense probably benign 0.03
R7062:Olfr955 UTSW 9 39470057 missense probably benign
R7765:Olfr955 UTSW 9 39470316 missense probably benign 0.28
R7847:Olfr955 UTSW 9 39470505 missense probably benign 0.42
R8122:Olfr955 UTSW 9 39470526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTACACTGCAGTAATTTCC -3'
(R):5'- CTCACACAGTCTTCCTGCTAAG -3'

Sequencing Primer
(F):5'- CACTGCAGTAATTTCCAAGAAAATC -3'
(R):5'- GTGATCTTTTCCCATTACTTGAGCTG -3'
Posted On2015-02-05