Incidental Mutation 'R2966:Gpr45'
ID264636
Institutional Source Beutler Lab
Gene Symbol Gpr45
Ensembl Gene ENSMUSG00000041907
Gene NameG protein-coupled receptor 45
SynonymsPSP24alpha, 9230112G11Rik
MMRRC Submission 040522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2966 (G1)
Quality Score170
Status Not validated
Chromosome1
Chromosomal Location42952872-43035456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43032508 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 104 (D104N)
Ref Sequence ENSEMBL: ENSMUSP00000135986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114761] [ENSMUST00000179766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114761
AA Change: D104N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110409
Gene: ENSMUSG00000041907
AA Change: D104N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 188 5.5e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179655
SMART Domains Protein: ENSMUSP00000136725
Gene: ENSMUSG00000096364

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179766
AA Change: D104N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135986
Gene: ENSMUSG00000041907
AA Change: D104N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 189 7.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.1e-51 PFAM
Meta Mutation Damage Score 0.1556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
9230110C19Rik C T 9: 8,027,174 R121Q probably damaging Het
Adamts1 A G 16: 85,796,774 V691A possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp11a A T 8: 12,847,853 probably null Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Bnc2 G A 4: 84,293,517 A300V probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gabra5 T C 7: 57,408,641 E453G probably damaging Het
Gatd1 T A 7: 141,409,167 D193V probably damaging Het
Gm6871 T G 7: 41,573,440 T75P probably benign Het
Has2 A G 15: 56,682,137 L23P probably damaging Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Myh1 A G 11: 67,214,584 K1067E probably damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Nsd2 G C 5: 33,846,122 E205D probably benign Het
Pclo T C 5: 14,681,150 L3222P unknown Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Rbm15b A G 9: 106,885,592 L459P probably damaging Het
Recql A G 6: 142,363,587 V586A probably benign Het
Rprd2 A T 3: 95,766,433 probably null Het
Sis T A 3: 72,889,010 I1813L probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sympk T C 7: 19,030,544 V58A probably damaging Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r39 A C 6: 66,804,731 I201S possibly damaging Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Gpr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Gpr45 APN 1 43032292 missense possibly damaging 0.77
IGL01528:Gpr45 APN 1 43033223 missense probably benign 0.00
IGL01833:Gpr45 APN 1 43032242 missense probably benign
IGL02034:Gpr45 APN 1 43033318 makesense probably null
IGL02230:Gpr45 APN 1 43032656 missense probably damaging 1.00
IGL02279:Gpr45 APN 1 43032838 missense probably damaging 0.96
IGL02394:Gpr45 APN 1 43030112 intron probably benign
IGL02795:Gpr45 APN 1 43032493 missense possibly damaging 0.82
IGL02902:Gpr45 APN 1 43033211 missense possibly damaging 0.67
IGL03017:Gpr45 APN 1 43032356 missense possibly damaging 0.95
expansive UTSW 1 43032838 missense probably damaging 0.96
extensive UTSW 1 43033058 missense probably damaging 1.00
R0368:Gpr45 UTSW 1 43033016 missense probably damaging 1.00
R2964:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R2965:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R4551:Gpr45 UTSW 1 43032790 missense probably benign 0.00
R4681:Gpr45 UTSW 1 43032908 missense probably benign 0.00
R4821:Gpr45 UTSW 1 43030453 intron probably benign
R4966:Gpr45 UTSW 1 43033120 missense probably benign 0.00
R5054:Gpr45 UTSW 1 43032649 missense probably benign 0.38
R5319:Gpr45 UTSW 1 43032838 missense probably damaging 0.96
R5667:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R5671:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R7250:Gpr45 UTSW 1 43032371 missense probably damaging 1.00
R8117:Gpr45 UTSW 1 43033315 missense probably damaging 1.00
R8393:Gpr45 UTSW 1 43032235 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAATAATGATGCTGCTGATG -3'
(R):5'- TGAACGTCCAGCCAGTGAAG -3'

Sequencing Primer
(F):5'- CAATAATGATGCTGCTGATGATCGTG -3'
(R):5'- TCCAGCCAGTGAAGGAGGG -3'
Posted On2015-02-05