Incidental Mutation 'R2966:Bnc2'
ID264641
Institutional Source Beutler Lab
Gene Symbol Bnc2
Ensembl Gene ENSMUSG00000028487
Gene Namebasonuclin 2
Synonyms
MMRRC Submission 040522-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2966 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location84275095-84675275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84293517 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 300 (A300V)
Ref Sequence ENSEMBL: ENSMUSP00000099884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102820] [ENSMUST00000107198] [ENSMUST00000175800] [ENSMUST00000175969] [ENSMUST00000176418] [ENSMUST00000176601] [ENSMUST00000176612] [ENSMUST00000176691] [ENSMUST00000176947] [ENSMUST00000176971] [ENSMUST00000176998]
Predicted Effect probably benign
Transcript: ENSMUST00000102820
AA Change: A300V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099884
Gene: ENSMUSG00000028487
AA Change: A300V

DomainStartEndE-ValueType
low complexity region 362 378 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 469 492 4.72e-2 SMART
ZnF_C2H2 497 526 7.11e0 SMART
low complexity region 612 629 N/A INTRINSIC
low complexity region 633 642 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
ZnF_C2H2 861 884 1.62e0 SMART
ZnF_C2H2 889 916 4.81e0 SMART
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1048 1062 N/A INTRINSIC
ZnF_C2H2 1063 1086 1.03e-2 SMART
ZnF_C2H2 1091 1118 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107198
AA Change: A272V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102816
Gene: ENSMUSG00000028487
AA Change: A272V

DomainStartEndE-ValueType
low complexity region 334 350 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
ZnF_C2H2 441 464 4.72e-2 SMART
ZnF_C2H2 469 498 7.11e0 SMART
low complexity region 584 601 N/A INTRINSIC
low complexity region 605 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
ZnF_C2H2 833 856 1.62e0 SMART
ZnF_C2H2 861 888 4.81e0 SMART
low complexity region 963 980 N/A INTRINSIC
low complexity region 1020 1034 N/A INTRINSIC
ZnF_C2H2 1035 1058 1.03e-2 SMART
ZnF_C2H2 1063 1090 3.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175757
Predicted Effect probably benign
Transcript: ENSMUST00000175800
AA Change: A194V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134795
Gene: ENSMUSG00000028487
AA Change: A194V

DomainStartEndE-ValueType
low complexity region 256 272 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175969
Predicted Effect probably benign
Transcript: ENSMUST00000176418
AA Change: A305V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135569
Gene: ENSMUSG00000028487
AA Change: A305V

DomainStartEndE-ValueType
low complexity region 367 383 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176476
Predicted Effect probably benign
Transcript: ENSMUST00000176601
SMART Domains Protein: ENSMUSP00000135480
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.62e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176612
AA Change: A230V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135778
Gene: ENSMUSG00000028487
AA Change: A230V

DomainStartEndE-ValueType
low complexity region 292 308 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
ZnF_C2H2 399 422 4.72e-2 SMART
ZnF_C2H2 427 456 7.11e0 SMART
low complexity region 542 559 N/A INTRINSIC
low complexity region 563 572 N/A INTRINSIC
low complexity region 606 620 N/A INTRINSIC
ZnF_C2H2 791 814 1.62e0 SMART
low complexity region 832 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176691
AA Change: A205V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000135375
Gene: ENSMUSG00000028487
AA Change: A205V

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 374 397 4.72e-2 SMART
ZnF_C2H2 402 431 7.11e0 SMART
low complexity region 517 534 N/A INTRINSIC
low complexity region 538 547 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
ZnF_C2H2 766 789 1.62e0 SMART
ZnF_C2H2 794 821 4.81e0 SMART
low complexity region 896 913 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
ZnF_C2H2 968 991 1.03e-2 SMART
ZnF_C2H2 996 1023 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176702
SMART Domains Protein: ENSMUSP00000134774
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 105 128 1.62e0 SMART
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176947
Predicted Effect probably benign
Transcript: ENSMUST00000177277
Predicted Effect probably benign
Transcript: ENSMUST00000176971
SMART Domains Protein: ENSMUSP00000135607
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 3 28 1.98e2 SMART
low complexity region 103 120 N/A INTRINSIC
low complexity region 160 174 N/A INTRINSIC
ZnF_C2H2 175 198 1.03e-2 SMART
ZnF_C2H2 203 230 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176998
SMART Domains Protein: ENSMUSP00000135283
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.62e0 SMART
low complexity region 53 67 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved zinc finger protein. The encoded protein functions in skin color saturation. Mutations in this gene are associated with facial pigmented spots. This gene is also associated with susceptibility to adolescent idiopathic scoliosis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap insertion die within 24 hrs of birth and display cleft palate, an overall size reduction of the head and tongue, and abnormal craniofacial bone development due to impaired multiplication of embryonic craniofacial mesenchymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
9230110C19Rik C T 9: 8,027,174 R121Q probably damaging Het
Adamts1 A G 16: 85,796,774 V691A possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp11a A T 8: 12,847,853 probably null Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gabra5 T C 7: 57,408,641 E453G probably damaging Het
Gatd1 T A 7: 141,409,167 D193V probably damaging Het
Gm6871 T G 7: 41,573,440 T75P probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Has2 A G 15: 56,682,137 L23P probably damaging Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Myh1 A G 11: 67,214,584 K1067E probably damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Nsd2 G C 5: 33,846,122 E205D probably benign Het
Pclo T C 5: 14,681,150 L3222P unknown Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Rbm15b A G 9: 106,885,592 L459P probably damaging Het
Recql A G 6: 142,363,587 V586A probably benign Het
Rprd2 A T 3: 95,766,433 probably null Het
Sis T A 3: 72,889,010 I1813L probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sympk T C 7: 19,030,544 V58A probably damaging Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r39 A C 6: 66,804,731 I201S possibly damaging Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Bnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Bnc2 APN 4 84276241 splice site probably null
IGL01902:Bnc2 APN 4 84390944 missense probably damaging 1.00
IGL02228:Bnc2 APN 4 84293076 missense possibly damaging 0.70
IGL02396:Bnc2 APN 4 84276009 missense probably benign 0.16
R0125:Bnc2 UTSW 4 84292932 missense probably damaging 1.00
R0650:Bnc2 UTSW 4 84293196 missense probably benign 0.04
R1082:Bnc2 UTSW 4 84546335 missense probably damaging 1.00
R1334:Bnc2 UTSW 4 84276289 missense possibly damaging 0.49
R1439:Bnc2 UTSW 4 84276068 missense probably benign 0.38
R1447:Bnc2 UTSW 4 84293220 missense probably benign 0.13
R1515:Bnc2 UTSW 4 84414326 missense probably null 0.99
R1548:Bnc2 UTSW 4 84275957 missense probably damaging 1.00
R1818:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R1819:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R2345:Bnc2 UTSW 4 84292503 missense probably damaging 1.00
R2897:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2898:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R3404:Bnc2 UTSW 4 84546241 missense probably damaging 0.98
R4235:Bnc2 UTSW 4 84293514 missense probably damaging 0.96
R4546:Bnc2 UTSW 4 84291976 missense probably benign 0.34
R4676:Bnc2 UTSW 4 84292819 missense probably damaging 1.00
R4926:Bnc2 UTSW 4 84276179 missense probably damaging 1.00
R5060:Bnc2 UTSW 4 84531635 missense probably benign 0.02
R5365:Bnc2 UTSW 4 84411429 intron probably benign
R5735:Bnc2 UTSW 4 84292671 missense probably damaging 1.00
R5872:Bnc2 UTSW 4 84292770 missense possibly damaging 0.86
R5921:Bnc2 UTSW 4 84293055 missense possibly damaging 0.95
R5999:Bnc2 UTSW 4 84555900 missense probably benign 0.20
R6351:Bnc2 UTSW 4 84293143 missense probably benign 0.16
R6869:Bnc2 UTSW 4 84293496 missense probably damaging 1.00
R7236:Bnc2 UTSW 4 84555864 missense probably benign 0.31
R7363:Bnc2 UTSW 4 84292071 missense probably benign 0.02
R7643:Bnc2 UTSW 4 84506574 missense probably benign 0.01
R8017:Bnc2 UTSW 4 84411425 missense
R8019:Bnc2 UTSW 4 84411425 missense
R8050:Bnc2 UTSW 4 84292336 missense probably benign 0.00
R8311:Bnc2 UTSW 4 84276345 missense possibly damaging 0.69
X0021:Bnc2 UTSW 4 84293140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGGGGTTTATATACTGGAATGG -3'
(R):5'- GCACCTTCAGTTGCATTGAG -3'

Sequencing Primer
(F):5'- GGTTTATATACTGGAATGGAAGCAG -3'
(R):5'- CCTTCAGTTGCATTGAGTAATTATGC -3'
Posted On2015-02-05