Incidental Mutation 'R2966:Gatd1'
ID264664
Institutional Source Beutler Lab
Gene Symbol Gatd1
Ensembl Gene ENSMUSG00000051007
Gene Nameglutamine amidotransferase like class 1 domain containing 1
SynonymsD230016J19Rik, Pddc1
MMRRC Submission 040522-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2966 (G1)
Quality Score171
Status Not validated
Chromosome7
Chromosomal Location141407794-141414136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141409167 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 193 (D193V)
Ref Sequence ENSEMBL: ENSMUSP00000101630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106008]
Predicted Effect probably damaging
Transcript: ENSMUST00000106008
AA Change: D193V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101630
Gene: ENSMUSG00000051007
AA Change: D193V

DomainStartEndE-ValueType
PDB:1U9C|A 29 220 7e-10 PDB
SCOP:d1g2ia_ 54 206 7e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209276
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
9230110C19Rik C T 9: 8,027,174 R121Q probably damaging Het
Adamts1 A G 16: 85,796,774 V691A possibly damaging Het
Add1 C A 5: 34,630,714 D702E probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Atp11a A T 8: 12,847,853 probably null Het
Atp8a1 T C 5: 67,647,706 D1022G probably benign Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Bnc2 G A 4: 84,293,517 A300V probably benign Het
Cep250 A G 2: 155,994,878 K2256E probably benign Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col2a1 A G 15: 97,976,095 I1402T unknown Het
Ddx43 C A 9: 78,406,379 Y197* probably null Het
Dyrk2 T A 10: 118,860,337 K339* probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fgd6 T A 10: 94,044,194 F303L probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gabra5 T C 7: 57,408,641 E453G probably damaging Het
Gm6871 T G 7: 41,573,440 T75P probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Has2 A G 15: 56,682,137 L23P probably damaging Het
Lrriq1 A G 10: 103,214,900 S664P probably benign Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mgam T C 6: 40,768,220 V1807A possibly damaging Het
Myh1 A G 11: 67,214,584 K1067E probably damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Noa1 T C 5: 77,306,344 E483G possibly damaging Het
Nsd2 G C 5: 33,846,122 E205D probably benign Het
Pclo T C 5: 14,681,150 L3222P unknown Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Prss35 A G 9: 86,755,582 D135G probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rab21 T C 10: 115,294,909 N164S probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Rbm15b A G 9: 106,885,592 L459P probably damaging Het
Recql A G 6: 142,363,587 V586A probably benign Het
Rprd2 A T 3: 95,766,433 probably null Het
Sis T A 3: 72,889,010 I1813L probably benign Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sympk T C 7: 19,030,544 V58A probably damaging Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Usp48 G A 4: 137,613,762 V358M probably damaging Het
Vmn1r39 A C 6: 66,804,731 I201S possibly damaging Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Gatd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Gatd1 APN 7 141408960 makesense probably null
IGL02880:Gatd1 APN 7 141411038 missense possibly damaging 0.96
R1036:Gatd1 UTSW 7 141409132 missense probably damaging 1.00
R1553:Gatd1 UTSW 7 141409893 missense probably benign 0.06
R3902:Gatd1 UTSW 7 141409101 missense probably damaging 1.00
R4719:Gatd1 UTSW 7 141411068 missense probably benign 0.01
R4916:Gatd1 UTSW 7 141409097 nonsense probably null
R5013:Gatd1 UTSW 7 141408948 utr 3 prime probably benign
R7177:Gatd1 UTSW 7 141411034 missense possibly damaging 0.94
R7975:Gatd1 UTSW 7 141409868 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATGAATACATGGTCCAGGCTC -3'
(R):5'- CGTTGAGGACTTTGTGAAGGAC -3'

Sequencing Primer
(F):5'- TACATGGTCCAGGCTCAGCAC -3'
(R):5'- AAGGACTCTGGTGCTGGC -3'
Posted On2015-02-05