Mutagenetix > Incidental Mutation

Incidental Mutation 'R2966:Lrriq1'

264675

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

040522-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R2966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103214900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 664 (S664P)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

probably benign
Transcript: ENSMUST00000020043
AA Change: S664P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: S664P

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123364

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166240
AA Change: S664P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: S664P

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220380

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	C	T	7: 41,626,405	R511*	probably null	Het
9230110C19Rik	C	T	9: 8,027,174	R121Q	probably damaging	Het
Adamts1	A	G	16: 85,796,774	V691A	possibly damaging	Het
Add1	C	A	5: 34,630,714	D702E	probably benign	Het
Ap1s1	T	C	5: 137,037,503	D148G	probably damaging	Het
Asprv1	T	A	6: 86,628,366	C65S	probably damaging	Het
Atp11a	A	T	8: 12,847,853		probably null	Het
Atp8a1	T	C	5: 67,647,706	D1022G	probably benign	Het
Bahd1	C	T	2: 118,916,406	P169S	probably damaging	Het
Bnc2	G	A	4: 84,293,517	A300V	probably benign	Het
Cep250	A	G	2: 155,994,878	K2256E	probably benign	Het
Chrna2	T	C	14: 66,149,368	V321A	possibly damaging	Het
Chsy1	G	A	7: 66,172,164	G716R	probably damaging	Het
Col2a1	A	G	15: 97,976,095	I1402T	unknown	Het
Ddx43	C	A	9: 78,406,379	Y197*	probably null	Het
Dyrk2	T	A	10: 118,860,337	K339*	probably null	Het
Fbxw21	A	G	9: 109,145,510	I314T	probably benign	Het
Fgd6	T	A	10: 94,044,194	F303L	probably benign	Het
Fstl3	T	C	10: 79,781,223	V200A	probably benign	Het
Gabra5	T	C	7: 57,408,641	E453G	probably damaging	Het
Gatd1	T	A	7: 141,409,167	D193V	probably damaging	Het
Gm6871	T	G	7: 41,573,440	T75P	probably benign	Het
Gpr45	G	A	1: 43,032,508	D104N	possibly damaging	Het
Has2	A	G	15: 56,682,137	L23P	probably damaging	Het
Ltf	G	T	9: 111,028,472	C443F	possibly damaging	Het
Mgam	T	C	6: 40,768,220	V1807A	possibly damaging	Het
Myh1	A	G	11: 67,214,584	K1067E	probably damaging	Het
Nav2	C	T	7: 49,557,032	T1535I	probably damaging	Het
Noa1	T	C	5: 77,306,344	E483G	possibly damaging	Het
Nsd2	G	C	5: 33,846,122	E205D	probably benign	Het
Pclo	T	C	5: 14,681,150	L3222P	unknown	Het
Pnpla2	C	T	7: 141,458,478	L215F	probably damaging	Het
Prss35	A	G	9: 86,755,582	D135G	probably damaging	Het
Pth	T	C	7: 113,385,929	H79R	probably benign	Het
Rab21	T	C	10: 115,294,909	N164S	probably benign	Het
Rasal1	T	A	5: 120,671,620	L530Q	probably damaging	Het
Rbm15b	A	G	9: 106,885,592	L459P	probably damaging	Het
Recql	A	G	6: 142,363,587	V586A	probably benign	Het
Rprd2	A	T	3: 95,766,433		probably null	Het
Sis	T	A	3: 72,889,010	I1813L	probably benign	Het
Slc4a5	C	T	6: 83,296,669	T997I	probably damaging	Het
Sympk	T	C	7: 19,030,544	V58A	probably damaging	Het
Trav7d-4	C	T	14: 52,770,127	Q26*	probably null	Het
Usp48	G	A	4: 137,613,762	V358M	probably damaging	Het
Vmn1r39	A	C	6: 66,804,731	I201S	possibly damaging	Het
Zcchc8	A	G	5: 123,720,867	S22P	probably benign	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8304:Lrriq1	UTSW	10	103234068	missense	possibly damaging	0.57
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAAGTCAGGACACCATCAGCTT -3'
(R):5'- GTGGGCCATCGGATGAGAAT -3'

Sequencing Primer
(F):5'- GACACCATCAGCTTCAGCCTTTG -3'
(R):5'- TCGGATGAGAATAATAGCTCACC -3'

Posted On

2015-02-05